ID: 968626793

View in Genome Browser
Species Human (GRCh38)
Location 4:1629449-1629471
Sequence GTGCCCTGGAGGCCTGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968626787_968626793 -9 Left 968626787 4:1629435-1629457 CCTGGGCCTCGACTGTGCCCTGG 0: 1
1: 0
2: 1
3: 23
4: 273
Right 968626793 4:1629449-1629471 GTGCCCTGGAGGCCTGGCCAGGG No data
968626785_968626793 2 Left 968626785 4:1629424-1629446 CCCGAGTCAGTCCTGGGCCTCGA 0: 1
1: 0
2: 0
3: 12
4: 106
Right 968626793 4:1629449-1629471 GTGCCCTGGAGGCCTGGCCAGGG No data
968626781_968626793 15 Left 968626781 4:1629411-1629433 CCCTCTAGGGTGGCCCGAGTCAG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 968626793 4:1629449-1629471 GTGCCCTGGAGGCCTGGCCAGGG No data
968626779_968626793 24 Left 968626779 4:1629402-1629424 CCTCAGGACCCCTCTAGGGTGGC 0: 1
1: 0
2: 5
3: 12
4: 118
Right 968626793 4:1629449-1629471 GTGCCCTGGAGGCCTGGCCAGGG No data
968626786_968626793 1 Left 968626786 4:1629425-1629447 CCGAGTCAGTCCTGGGCCTCGAC 0: 1
1: 0
2: 1
3: 5
4: 101
Right 968626793 4:1629449-1629471 GTGCCCTGGAGGCCTGGCCAGGG No data
968626782_968626793 14 Left 968626782 4:1629412-1629434 CCTCTAGGGTGGCCCGAGTCAGT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 968626793 4:1629449-1629471 GTGCCCTGGAGGCCTGGCCAGGG No data
968626780_968626793 16 Left 968626780 4:1629410-1629432 CCCCTCTAGGGTGGCCCGAGTCA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 968626793 4:1629449-1629471 GTGCCCTGGAGGCCTGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968626793 Original CRISPR GTGCCCTGGAGGCCTGGCCA GGG Intronic
No off target data available for this crispr