ID: 968626985

View in Genome Browser
Species Human (GRCh38)
Location 4:1630172-1630194
Sequence CAGCTCCGACAGCTTGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 791
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 736}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968626985_968626996 29 Left 968626985 4:1630172-1630194 CCCCTTCCAAGCTGTCGGAGCTG 0: 1
1: 0
2: 3
3: 51
4: 736
Right 968626996 4:1630224-1630246 GCCCTGGTGCCACCTGCTGCAGG No data
968626985_968626993 7 Left 968626985 4:1630172-1630194 CCCCTTCCAAGCTGTCGGAGCTG 0: 1
1: 0
2: 3
3: 51
4: 736
Right 968626993 4:1630202-1630224 GGCAGGTGCACAAGACAGCCTGG 0: 1
1: 1
2: 2
3: 26
4: 350
968626985_968626994 13 Left 968626985 4:1630172-1630194 CCCCTTCCAAGCTGTCGGAGCTG 0: 1
1: 0
2: 3
3: 51
4: 736
Right 968626994 4:1630208-1630230 TGCACAAGACAGCCTGGCCCTGG 0: 1
1: 0
2: 4
3: 51
4: 440
968626985_968626998 30 Left 968626985 4:1630172-1630194 CCCCTTCCAAGCTGTCGGAGCTG 0: 1
1: 0
2: 3
3: 51
4: 736
Right 968626998 4:1630225-1630247 CCCTGGTGCCACCTGCTGCAGGG 0: 1
1: 0
2: 3
3: 35
4: 317
968626985_968626990 -10 Left 968626985 4:1630172-1630194 CCCCTTCCAAGCTGTCGGAGCTG 0: 1
1: 0
2: 3
3: 51
4: 736
Right 968626990 4:1630185-1630207 GTCGGAGCTGCCCACGAGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968626985 Original CRISPR CAGCTCCGACAGCTTGGAAG GGG (reversed) Intronic
901301042 1:8200345-8200367 CAGCTGGGACAGGTTGGAAAGGG + Intergenic
901384512 1:8898704-8898726 AAGCTTCCACAGCATGGAAGGGG - Intergenic
902030295 1:13417144-13417166 AAGCTTCCACAGCGTGGAAGGGG + Intronic
904070243 1:27790325-27790347 AAGCTTCCACAGCGTGGAAGAGG + Intronic
904362070 1:29982538-29982560 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
904645533 1:31963200-31963222 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
904878815 1:33678662-33678684 CAGCTCGGTCAGCTTAGAGGGGG - Intronic
905169610 1:36101553-36101575 AGGCTCCCACAGCTGGGAAGGGG - Intronic
905363638 1:37436911-37436933 CAATTCACACAGCTTGGAAGTGG - Intergenic
905642917 1:39604042-39604064 AAGCTTCCACAGCTTGGAAGGGG - Intergenic
905885422 1:41489270-41489292 CATGTCAGACAGCTAGGAAGTGG + Intergenic
905950309 1:41945299-41945321 CTCCTCCCACAGCTTGGAGGGGG - Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
906701332 1:47860300-47860322 CAGCTGTGGTAGCTTGGAAGAGG - Intronic
906766329 1:48438084-48438106 AAGCTTCCACAGCGTGGAAGGGG - Intronic
906767227 1:48444680-48444702 AAGCTTCCACAGCATGGAAGGGG - Intronic
906988945 1:50716865-50716887 AAGCTTCCACAGCGTGGAAGGGG - Intronic
907793486 1:57691474-57691496 AAGCTTCCACAGCATGGAAGGGG - Intronic
908848409 1:68348538-68348560 AAGCTTCTACAGCATGGAAGGGG - Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
909358942 1:74740421-74740443 AAGCTTCTGCAGCTTGGAAGGGG + Intronic
909359619 1:74745256-74745278 AAGCTTCCACAGCTTGGAAGGGG + Intronic
909604745 1:77497015-77497037 AAGCTTCCACAGCATGGAAGGGG - Intronic
910397849 1:86809544-86809566 AAGCTTCCACAGCATGGAAGGGG + Intergenic
911297940 1:96140398-96140420 AAGCTTCCACAGCATGGAAGGGG - Intergenic
911299350 1:96153405-96153427 AAGCTTCCACAGCATGGAAGGGG - Intergenic
911345414 1:96691132-96691154 AAGCTTCCACAGCATGGAAGGGG - Intergenic
911751103 1:101499259-101499281 AAGCTTCCACAGCATGGAAGAGG - Intergenic
912020974 1:105109336-105109358 AAGCTTCCACAGCATGGAAGGGG - Intergenic
913279574 1:117172967-117172989 AAGCTTCCACAGCATGGAAGGGG - Intronic
913297725 1:117337807-117337829 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
913382319 1:118225908-118225930 AAGCTTCCACAGCTTGGAAGGGG - Intergenic
913383364 1:118233257-118233279 AAGCTTCCACAGCATGGAAGGGG - Intergenic
913419357 1:118647996-118648018 AAGCTCCCACAGTGTGGAAGGGG - Intergenic
915444748 1:155968258-155968280 AAGCTCCCACAGCGTAGAAGGGG + Intronic
916083291 1:161250442-161250464 AAGCTTCCACAGCATGGAAGGGG - Intergenic
916084323 1:161257637-161257659 AAGCTTCCACAGCATGGAAGGGG - Intergenic
916220016 1:162434049-162434071 AAGCTCCCACAGTGTGGAAGGGG - Intergenic
916274259 1:162976916-162976938 CAACTGCGTGAGCTTGGAAGTGG - Intergenic
916554652 1:165883743-165883765 AAGCTTCCACAGCATGGAAGGGG - Intronic
916812726 1:168319649-168319671 CAGCTCAGACAGCGTAGATGGGG + Intergenic
916940216 1:169669018-169669040 AAGCTTCCACAGCGTGGAAGGGG - Intronic
916943147 1:169697294-169697316 AAGCTTCCACAGCGTGGAAGGGG + Intronic
917025756 1:170639569-170639591 AAGCTTCCACAGCATGGAAGGGG - Intergenic
917078234 1:171228439-171228461 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
917085821 1:171305242-171305264 AAGCTTCCACAGCATGGAAGGGG - Intergenic
917675929 1:177319680-177319702 AAGCTTCCACAGCATGGAAGGGG - Intergenic
917848924 1:179043407-179043429 CTGCTCCACCATCTTGGAAGAGG + Intronic
918024136 1:180726325-180726347 AAGCTTCCACAGCATGGAAGGGG - Intronic
918749684 1:188257520-188257542 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
918750490 1:188263491-188263513 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
918958014 1:191236129-191236151 CAGCCCCTACATCTTCGAAGAGG + Intergenic
918965581 1:191343572-191343594 AAGCTTCCACAGCATGGAAGGGG + Intergenic
919009036 1:191935953-191935975 AAGCTTCCACAGCATGGAAGGGG + Intergenic
919085118 1:192911880-192911902 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
919252469 1:195074722-195074744 AAGCTTCCACAGCATGGAAGGGG - Intergenic
919631078 1:199960428-199960450 AAGCTTCCACAGCGTGGAAGAGG - Intergenic
919823496 1:201487762-201487784 CAGATCCGCTAGCTAGGAAGGGG - Intronic
919838714 1:201594126-201594148 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
920731229 1:208487951-208487973 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
920883018 1:209898355-209898377 CAGCTTCCACAGTGTGGAAGGGG + Intergenic
921382448 1:214538322-214538344 CAGCTCTCACAGCTAGTAAGTGG - Intronic
923060088 1:230463904-230463926 CACCTCCGCAAGCTGGGAAGAGG - Intergenic
924378257 1:243436223-243436245 AAGCTTCCACAGCATGGAAGGGG + Intronic
924505749 1:244682145-244682167 AAGCTTCCACAGCGTGGAAGGGG + Intronic
924646757 1:245884924-245884946 AAGCTTCCACAGCGTGGAAGGGG - Intronic
1062774229 10:132208-132230 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1063415354 10:5868661-5868683 AAGCTTCCACAGCGTGGAAGGGG - Intronic
1063541056 10:6934291-6934313 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1063769835 10:9184154-9184176 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1063972967 10:11394295-11394317 AAGCTTCCACAGCCTGGAAGGGG - Intergenic
1064219479 10:13428292-13428314 AAGCTTCCACAGCATGGAAGCGG - Intergenic
1064602917 10:17011568-17011590 AAGCTTCCACAGCGTGGAAGGGG + Intronic
1064665649 10:17648451-17648473 AAGCTTCCACAGCATGGAAGGGG - Intronic
1064752483 10:18545155-18545177 CAGCTCTGGCAGCTGGGAAGTGG - Intergenic
1065082107 10:22139174-22139196 AAGCTTCCACAGCGTGGAAGTGG - Intergenic
1065389046 10:25163566-25163588 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1065709302 10:28500118-28500140 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1066190418 10:33050189-33050211 AAGCTCCCACAGTGTGGAAGGGG - Intergenic
1066219249 10:33319480-33319502 AAGCTTCCACAGCCTGGAAGGGG - Intronic
1066296237 10:34056360-34056382 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1068151569 10:53139140-53139162 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1068404549 10:56572980-56573002 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1068443785 10:57094997-57095019 CTGCCCCCACAACTTGGAAGGGG - Intergenic
1068484923 10:57645394-57645416 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1068499977 10:57832749-57832771 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1068953625 10:62803091-62803113 AAGCTTCCACAGCTTGGAAGGGG - Intergenic
1069152689 10:64984899-64984921 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1069161716 10:65101249-65101271 CCTGTCTGACAGCTTGGAAGAGG + Intergenic
1069364573 10:67684022-67684044 AAGCTTCCACAGCATGGAAGGGG + Intronic
1069371232 10:67749933-67749955 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1069526391 10:69175719-69175741 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1069967885 10:72136651-72136673 AAGCTTCCACAGCATGGAAGGGG - Intronic
1070073209 10:73109803-73109825 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1070201307 10:74208261-74208283 CAGCCCTGCCAACTTGGAAGTGG + Intronic
1071037306 10:81264069-81264091 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1071054248 10:81490710-81490732 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1071054255 10:81490782-81490804 AAGCTTCCACAGCATGGAAGAGG - Intergenic
1071682369 10:87718934-87718956 CAGGTCCTGCAGCTTGGAAGGGG - Intronic
1071762066 10:88619150-88619172 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1072341712 10:94458957-94458979 AAGCTTCCACAGCGTGGAAGGGG + Intronic
1072370697 10:94764163-94764185 AAGCTTCCACAGCATGGAAGGGG + Intronic
1072927075 10:99625233-99625255 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1073060702 10:100731700-100731722 GAGCTCAGACAGCTGGCAAGGGG - Intergenic
1073532909 10:104249094-104249116 AAGCTCCCACAGCCCGGAAGGGG - Intronic
1074612683 10:115037109-115037131 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1074742269 10:116497014-116497036 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1075112242 10:119596745-119596767 CAGCCGCGACAGCCTGCAAGGGG + Intronic
1075254038 10:120910122-120910144 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1075384473 10:122045405-122045427 AAGATCACACAGCTTGGAAGTGG - Intronic
1076724206 10:132405769-132405791 CAGCAGCGACAGCCTGGACGAGG + Exonic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1077918938 11:6629107-6629129 AAGCTCATGCAGCTTGGAAGTGG - Intronic
1079292047 11:19197061-19197083 CAGATCACACAGCTTCGAAGAGG - Intronic
1079469790 11:20767262-20767284 AAGCTTCCACAGCATGGAAGGGG + Intronic
1079650246 11:22919646-22919668 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1079708550 11:23652709-23652731 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1080187083 11:29502897-29502919 AAGCTTCCACAGCGTGGAAGAGG + Intergenic
1080733039 11:34980405-34980427 AAGCTTCCACAGCATGGAAGGGG + Intronic
1081033839 11:38116961-38116983 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1081181505 11:39990798-39990820 AAGCTTCCACAGCTTGGAAAGGG - Intergenic
1081675701 11:44967821-44967843 CAGCTCCTGCAGCTTGCCAGAGG + Intergenic
1082620840 11:55419960-55419982 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1082948987 11:58790143-58790165 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1083417467 11:62535008-62535030 CAGCTCCTGCAGCTCTGAAGTGG - Exonic
1083891718 11:65598845-65598867 CAGCTCCCACAGCTAGTAAGTGG - Intronic
1084024595 11:66440199-66440221 AAGCTCCCACAGTGTGGAAGGGG + Intronic
1084437091 11:69149394-69149416 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1085886825 11:80532118-80532140 AAGCTTCCACAGCATGGAAGCGG + Intergenic
1086143354 11:83523516-83523538 AAGCTCCTACAGCTAGTAAGTGG - Intronic
1086273464 11:85096238-85096260 AAGCTTCCACAGCCTGGAAGGGG - Intronic
1086318056 11:85613782-85613804 AAGCTTCTACAGCGTGGAAGGGG - Intronic
1086397601 11:86432958-86432980 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1087458604 11:98419554-98419576 AAGCTTCCACAGCATGGAAGAGG + Intergenic
1087964683 11:104398139-104398161 AAGCTTCCACAGCGTGGAAGAGG + Intergenic
1087965631 11:104410650-104410672 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1088239723 11:107760655-107760677 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1088493252 11:110406732-110406754 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1088619916 11:111671337-111671359 CAGCTCCACCAGCTTGGCATTGG + Intronic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1090229381 11:125090463-125090485 AAGCTCCCACAGCGTGGAAGGGG - Intronic
1090270919 11:125385623-125385645 CACCTCCGCCAGCTTTGATGTGG + Exonic
1090384978 11:126352546-126352568 CAGCACTGATGGCTTGGAAGGGG + Intergenic
1090513150 11:127396825-127396847 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1091335309 11:134762112-134762134 CTGCTCCCACAGCTGGGGAGTGG - Intergenic
1091488058 12:908690-908712 CAGTTCCCACAGGTTGGAACTGG - Exonic
1091573266 12:1710253-1710275 AAGCTTCCACAGCATGGAAGGGG - Intronic
1092714315 12:11372739-11372761 AAGCTTCCACAGCATGGAAGGGG + Intronic
1092718029 12:11411760-11411782 AAGCTTCCACAGCATGGAAGGGG + Intronic
1093281914 12:17204823-17204845 CAGCTCCGGCAGCTGGCAACAGG - Intergenic
1093967459 12:25342269-25342291 AAGCTCCAACAGCATGGAAAAGG - Intergenic
1094238494 12:28195001-28195023 AAGCTTCCACAGCATGGAAGGGG + Intronic
1094327704 12:29257490-29257512 AAGCTTCCACAGCGTGGAAGAGG - Intronic
1094666636 12:32526638-32526660 AAGCTCCCACAGTGTGGAAGGGG - Intronic
1094732925 12:33199428-33199450 AAGCTCCCACAGCGTGGAAGGGG - Intergenic
1094736543 12:33241045-33241067 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1097149743 12:56967934-56967956 CATCTCCCACAGCTTGGAGGGGG + Intergenic
1097211864 12:57377001-57377023 AAGCTTCCACAGCATGGAAGGGG - Intronic
1097428651 12:59475813-59475835 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098956210 12:76692550-76692572 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1098956945 12:76697454-76697476 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1099375972 12:81896786-81896808 AAGCTTCCACAGCCTGGAAGGGG - Intergenic
1099415054 12:82374278-82374300 AAGCTTCCACAGCATGGAAGGGG + Intronic
1099576473 12:84390290-84390312 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1099577191 12:84395440-84395462 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1099797818 12:87421214-87421236 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1100027479 12:90147724-90147746 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1100050479 12:90443494-90443516 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1100078976 12:90824640-90824662 AATCTTCCACAGCTTGGAAGGGG - Intergenic
1100210535 12:92394025-92394047 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1100600796 12:96109928-96109950 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1101050724 12:100861012-100861034 AAGCTTCCACAGCATGGAAGGGG + Intronic
1102959025 12:117080093-117080115 AAGGTCCCACAGCTAGGAAGAGG + Intronic
1104766787 12:131335222-131335244 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1104767902 12:131342235-131342257 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1105437118 13:20388896-20388918 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1105763255 13:23532456-23532478 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1105806087 13:23952321-23952343 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1105871023 13:24506376-24506398 AAGCTTCCACAGCGTGGAAGAGG + Intronic
1106471093 13:30054902-30054924 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1107790946 13:44001749-44001771 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1108113494 13:47102762-47102784 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1108118893 13:47161404-47161426 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1108157066 13:47596170-47596192 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1108725431 13:53175567-53175589 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1108735473 13:53279152-53279174 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1108849264 13:54707449-54707471 AAGCTTCCACAGCTTGGAAGGGG - Intergenic
1108867677 13:54941547-54941569 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1108958303 13:56188184-56188206 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1109272295 13:60268135-60268157 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1109411258 13:61972406-61972428 AAGCTTCCACAGCATGGAAGTGG + Intergenic
1109425210 13:62158066-62158088 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1109501138 13:63236968-63236990 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1109523640 13:63545548-63545570 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1109931673 13:69224689-69224711 CTCCTCCCACTGCTTGGAAGGGG - Intergenic
1110751268 13:79119189-79119211 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1110802353 13:79713654-79713676 CAGCTCCAAAAGCTTAGAATAGG - Intergenic
1110887615 13:80658375-80658397 AAGGTCCCACAGCGTGGAAGGGG + Intergenic
1111017232 13:82397259-82397281 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1111250539 13:85595519-85595541 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1111338004 13:86847150-86847172 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1111532094 13:89550869-89550891 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1111710213 13:91802481-91802503 AAGCTTCCACAGCATGGAAGGGG + Intronic
1111805145 13:93031387-93031409 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1112402377 13:99087316-99087338 CAGCTGCGTCACCTTGGACGTGG + Intergenic
1113204238 13:107897248-107897270 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1113338447 13:109399418-109399440 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1113480003 13:110613863-110613885 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1113550504 13:111189602-111189624 AAGCTTCCACAGCGTGGAAGGGG + Intronic
1114159246 14:20144515-20144537 CAGCTGGGAAAGCCTGGAAGGGG - Exonic
1115174426 14:30546612-30546634 AAGCTCCCACAGTGTGGAAGGGG + Intergenic
1115284844 14:31705323-31705345 AAGCTTCCACAGCGTGGAAGGGG + Intronic
1115285827 14:31712050-31712072 AAGCTTCCACAGCATGGAAGGGG + Intronic
1115421218 14:33198226-33198248 AAGCTTCCACAGCATGGAAGGGG + Intronic
1115736900 14:36342130-36342152 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116305288 14:43246130-43246152 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1116346860 14:43804627-43804649 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1116696137 14:48180957-48180979 AAGCTTCCACAGCTTGGAAGGGG + Intergenic
1118374356 14:65163719-65163741 CAGCTCCTACAGCTTGTGAGAGG + Intergenic
1118532149 14:66718496-66718518 AAGCTTCCACAGCGTGGAAGGGG + Intronic
1118596777 14:67441688-67441710 CACCTCCAACAGATTGGATGAGG - Intergenic
1120103767 14:80472151-80472173 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1120331125 14:83093386-83093408 AAGCTTCCACAGCGTGGAAGAGG - Intergenic
1120860710 14:89252980-89253002 AAGCTCCGAGAGCTTGGAAGGGG + Intronic
1121154339 14:91668563-91668585 AAGCTTCCACAGCATGGAAGGGG - Intronic
1121288095 14:92752190-92752212 CAGCTCACACAGCTTGTAAGTGG - Intergenic
1121358180 14:93232256-93232278 CAGCTTCCACAGCCAGGAAGTGG + Intergenic
1123948978 15:25252546-25252568 AAGCTTCCACAGTTTGGAAGGGG + Intergenic
1124056475 15:26244804-26244826 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1125255286 15:37756574-37756596 AAGCTCTGACAGCTTGAATGAGG - Intergenic
1125555540 15:40581796-40581818 CAGCTTCCACAGCATGGAAGGGG + Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126188157 15:45850882-45850904 GAGCTGCCACAGCATGGAAGGGG + Intergenic
1126723946 15:51611963-51611985 AAGCTTCCACAGCATGGAAGGGG - Intronic
1127093269 15:55487501-55487523 AAGCTTCCACAGCATGGAAGGGG - Intronic
1128311867 15:66636010-66636032 AAGCTCCCACAGCTGGGCAGTGG - Intronic
1128397843 15:67246932-67246954 AAGCTTCCACAGCGTGGAAGGGG - Intronic
1128469066 15:67936833-67936855 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129888661 15:79056537-79056559 AAGCTCACACAGCTGGGAAGTGG - Intronic
1130028520 15:80291154-80291176 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1130161875 15:81409662-81409684 AACCTCCCACAGCCTGGAAGGGG - Intergenic
1133195765 16:4169126-4169148 CACCTCCATGAGCTTGGAAGTGG + Intergenic
1133367390 16:5221488-5221510 AAGCTGCCACAGCGTGGAAGGGG + Intergenic
1133823267 16:9255854-9255876 CAGCTCTGCCACCTTGGAATTGG + Intergenic
1134300101 16:12983279-12983301 AAGCTCACACAGCTTGAAAGTGG - Intronic
1134914850 16:18060898-18060920 CAGCCCCCACAGCATGGAGGGGG - Intergenic
1135297127 16:21290159-21290181 AAGTTCCCACAGCATGGAAGGGG - Intronic
1135923724 16:26673900-26673922 CAGCTCCCTCAGCCTGAAAGGGG + Intergenic
1136590751 16:31216363-31216385 AAGCTTCCACAGCATGGAAGGGG - Intronic
1137613999 16:49836300-49836322 CAGCTTGGACAGGTTGGAGGTGG - Intronic
1138643072 16:58401382-58401404 AAGCTTCCACAGCGTGGAAGGGG + Intronic
1139339525 16:66259014-66259036 CAGGTCACACAGCTGGGAAGTGG + Intergenic
1139965558 16:70743396-70743418 AAGCTTCCACAGCGTGGAAGGGG - Intronic
1140473560 16:75227722-75227744 CAGCTCAGAGGGCTGGGAAGAGG - Intergenic
1141949814 16:87333276-87333298 CAGCTGCGACTGCGTGGGAGGGG - Intronic
1142328641 16:89435382-89435404 CAGCTCCCACAGCATGGAAGGGG - Intronic
1142989037 17:3717072-3717094 ATGCTCTGACAGCTTGAAAGAGG + Intronic
1144723359 17:17487317-17487339 AAGCTTCCACAGCATGGAAGGGG - Intronic
1145803823 17:27712253-27712275 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1146295113 17:31643451-31643473 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1147404073 17:40198339-40198361 AAGCTCCCACAGCGTGGAAGGGG - Intergenic
1147978294 17:44260244-44260266 CATCTCTGACACCTTGAAAGGGG - Intronic
1149077885 17:52617882-52617904 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1149223240 17:54439516-54439538 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1152726381 17:81948800-81948822 CAGCTCCCACAGCACGGCAGGGG + Intergenic
1153300482 18:3587608-3587630 AAGCTTCCACAGCATGGAAGGGG - Intronic
1153438442 18:5090798-5090820 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1153754510 18:8266303-8266325 AAGCTTCCACAGCGTGGAAGGGG - Intronic
1155966236 18:32037964-32037986 AAGCTCCCACAACATGGAAGGGG - Intronic
1156157524 18:34321140-34321162 CAGCACTGGCTGCTTGGAAGAGG + Intergenic
1157045288 18:44095318-44095340 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157427345 18:47595281-47595303 CAGTGCCGACAGCCTGGAGGAGG - Intergenic
1157776224 18:50398529-50398551 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1158460580 18:57642979-57643001 AAGCTCCCACAGTGTGGAAGGGG + Intergenic
1158744136 18:60178266-60178288 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1159163286 18:64671679-64671701 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1159655813 18:71029499-71029521 AAGCTTCCACAGTTTGGAAGGGG + Intergenic
1160750403 19:731388-731410 CGGCTCACACAGCTGGGAAGTGG - Intronic
1161227348 19:3153019-3153041 AAGCTTCCACAGCGTGGAAGGGG - Intronic
1161430822 19:4231321-4231343 CAGGTCGGAGAGCCTGGAAGGGG + Exonic
1161597561 19:5158570-5158592 AAGCTTCCACAGCGTGGAAGGGG + Intronic
1161598530 19:5165551-5165573 AAGCTTCCACAGCGTGGAAGGGG + Intronic
1161897366 19:7092643-7092665 AAGCTTCCACAGCTTGGAAGGGG - Intergenic
1162230280 19:9260320-9260342 AAACTCCCACAGTTTGGAAGAGG - Intergenic
1162232948 19:9282847-9282869 AAGCTTCCATAGCTTGGAAGGGG + Intergenic
1162261940 19:9541009-9541031 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1163463385 19:17452682-17452704 CAGCTCAGACAGGTGGGGAGTGG + Intronic
1164029548 19:21390051-21390073 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1164411359 19:28008529-28008551 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1165121384 19:33561098-33561120 CAGCTCCTTCAGCCTGGAAGAGG - Intergenic
1165558005 19:36652740-36652762 AAGCTTCCACAGCATGGAAGGGG - Intronic
1168701574 19:58442889-58442911 AAGCTTCTACAGCATGGAAGAGG + Intergenic
925906886 2:8545024-8545046 CACCTCCGAGAGATGGGAAGGGG - Intergenic
925952804 2:8930901-8930923 AAGCTTCCACAGCATGGAAGGGG - Intronic
926116932 2:10219303-10219325 CAACTCACACAGCTGGGAAGTGG + Intergenic
927777947 2:25916475-25916497 AAGCTTCCACAGCATGGAAGGGG - Intergenic
928106685 2:28475082-28475104 AAGCTTCCACAGCATGGAAGGGG + Intronic
928239514 2:29574390-29574412 CAGCACAGACAGGTGGGAAGAGG - Intronic
928595938 2:32858837-32858859 AAGCTTCCACAGCATGGAAGGGG + Intergenic
928747457 2:34432477-34432499 AAGCTCCCACAGCGTGGAAGGGG - Intergenic
929233843 2:39586162-39586184 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
929254181 2:39791611-39791633 AAGCTTCCACAGCATGGAAGGGG + Intergenic
930875706 2:56213188-56213210 CAGCTCTGACAGCTTTCAAATGG + Intronic
931020736 2:58041920-58041942 AAGGCCCGACAGCTTGAAAGGGG - Intronic
931540128 2:63322359-63322381 AAGCTTCCACAGCATGGAAGGGG - Intronic
932374317 2:71222028-71222050 AAGCTTCCACAGCCTGGAAGGGG - Intronic
932486590 2:72087519-72087541 CAGCTTCCACAGTGTGGAAGGGG - Intergenic
932687414 2:73883994-73884016 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
933463740 2:82623569-82623591 CAGCTCAGACAACCCGGAAGAGG + Intergenic
933730873 2:85455469-85455491 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
933858636 2:86442131-86442153 CAGCCACGACAGCTGGGACGTGG + Exonic
934867881 2:97829618-97829640 AAGCTTCCACAGCGTGGAAGGGG - Intronic
935183024 2:100706925-100706947 CAGCTCCGAGCGCTGGGCAGGGG + Intergenic
935789404 2:106577293-106577315 AAGCTTCCACAGCATGGAAGGGG + Intergenic
936057527 2:109272109-109272131 CAGCTCCGACAGCTGGCCAGAGG - Intronic
936803044 2:116289438-116289460 AAGCTTCCACAGCATGGAAGGGG - Intergenic
938805544 2:134804031-134804053 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
938806532 2:134811375-134811397 AAGCTTCCACAGCATGGAAGGGG + Intergenic
939085248 2:137710576-137710598 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
939085806 2:137716667-137716689 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
939255881 2:139744240-139744262 AAGCTTCCACAGCATGGAAGGGG - Intergenic
939551930 2:143626530-143626552 AAGCTTCCACAGCATGGAAGGGG + Intronic
939912101 2:147995479-147995501 AAGCTTCCACAGCGTGGAAGGGG - Intronic
941272703 2:163450565-163450587 CAGCTTCCACAACGTGGAAGGGG - Intergenic
941313520 2:163964179-163964201 AAGCTTCCACAGCATGGAAGGGG + Intergenic
941537897 2:166744046-166744068 AAGCTTCCACAGCATGGAAGGGG + Intergenic
942098663 2:172556645-172556667 CGGGTCCGACTCCTTGGAAGGGG - Intronic
942172475 2:173301538-173301560 AAGCTCCCACAGCGTGGAAGGGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
943103390 2:183512765-183512787 AAGCTTCCACAGCATGGAAGGGG + Intergenic
943211463 2:184972953-184972975 AAGCTTCCACAGCATGGAAGGGG + Intergenic
943294247 2:186116817-186116839 AAGCTTCCACAGCATGGAAGAGG + Intergenic
943577733 2:189651018-189651040 AAGCTTCCACAGCATGGAAGGGG - Intergenic
944053108 2:195493768-195493790 AAGCTTCCACAGCATGGAAGGGG - Intergenic
944706170 2:202291143-202291165 CAACTCAGAAAGCTTGGCAGAGG - Exonic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
944812848 2:203345062-203345084 AAGCTTCCACAGCATGGAAGAGG - Intronic
944879286 2:203994919-203994941 AAGATCCCACAGCTAGGAAGTGG + Intergenic
945600854 2:211863391-211863413 AAGCTTCCACAGCATGGAAGGGG - Intronic
945869279 2:215208665-215208687 AAGCTTCCACAGCATGGAAGGGG - Intergenic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
946676914 2:222170103-222170125 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
946729687 2:222697083-222697105 TAGCTCCCTCAGATTGGAAGAGG + Intronic
947812635 2:233014203-233014225 CAACACCAGCAGCTTGGAAGTGG - Intronic
948643425 2:239389265-239389287 AAGCTTCCACAGCATGGAAGGGG - Intronic
1169200192 20:3705532-3705554 CACCTCCTACTGCTTCGAAGGGG - Intronic
1169268526 20:4182106-4182128 CAGCTCACACAGCATGGACGAGG + Exonic
1169647759 20:7833040-7833062 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1169647956 20:7834492-7834514 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1170986539 20:21264565-21264587 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1171262013 20:23742354-23742376 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1172082248 20:32351232-32351254 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1172346512 20:34205544-34205566 AAGCTTCCACAGCGTGGAAGGGG + Intronic
1173524553 20:43721749-43721771 CCGCCCCGCCAACTTGGAAGGGG + Intergenic
1173907557 20:46639931-46639953 AAGCTCCCACAGCTGGGAAGTGG - Intronic
1174092914 20:48063658-48063680 TAGCTCCGTCAGCTTGAATGAGG + Intergenic
1174849071 20:53974239-53974261 AAGCTTCCACAGCGTGGAAGGGG - Intronic
1175658201 20:60790281-60790303 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1176231563 20:64035778-64035800 CAGGTCCGGCAGCTGGGGAGGGG + Intronic
1176317144 21:5257068-5257090 CCTCTCTGACAGCTTTGAAGAGG - Intergenic
1177140715 21:17354671-17354693 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1177262452 21:18748639-18748661 CTGCTCTGCCAGCTTAGAAGGGG + Intergenic
1178082111 21:29076758-29076780 AAGCTCCCACAGTGTGGAAGGGG + Intergenic
1178109354 21:29355036-29355058 AAGCTTCCACAGCATGGAAGGGG + Intronic
1178136233 21:29630583-29630605 CAACTACGTGAGCTTGGAAGAGG + Intronic
1178583686 21:33856040-33856062 CAGGTCTCTCAGCTTGGAAGTGG - Intronic
1181076685 22:20383104-20383126 AAGCTCCCACAGTGTGGAAGGGG + Intronic
1181450393 22:23016460-23016482 AAGCTCCCACAGCGTGGAAGGGG + Intergenic
1182008900 22:26984046-26984068 AGGATCCCACAGCTTGGAAGTGG + Intergenic
1183048382 22:35240559-35240581 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1183351195 22:37335602-37335624 CTGCGCAGACAGCCTGGAAGAGG + Intergenic
1183421983 22:37717344-37717366 AAGCTTCCACAGCATGGAAGAGG + Intronic
1183739363 22:39661617-39661639 CTGGTCACACAGCTTGGAAGTGG - Intronic
1184087810 22:42275720-42275742 CAGGTCACACAGCTAGGAAGAGG + Intronic
949449292 3:4167233-4167255 AAGCTTCCACAGCATGGAAGGGG + Intronic
949741312 3:7237713-7237735 AAGCTTCCACAGCGTGGAAGTGG + Intronic
949880434 3:8656750-8656772 AAGCTCCTACAGGTGGGAAGTGG + Intronic
950012756 3:9734655-9734677 CACCTCTGGCAGCTTGGGAGTGG - Exonic
950238774 3:11348659-11348681 AAGCTTCCACAGCGTGGAAGGGG + Intronic
950256528 3:11511150-11511172 AAGCTTCCACAGCGTGGAAGGGG + Intronic
950270067 3:11606826-11606848 AAGCTTCCACAGCGTGGAAGGGG - Intronic
950286924 3:11752321-11752343 AAGCTTCCACAGCATGGAAGGGG + Intergenic
951200761 3:19873652-19873674 CTCCTCCCACTGCTTGGAAGGGG + Intergenic
952554678 3:34518958-34518980 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
952555375 3:34524158-34524180 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
952713453 3:36454151-36454173 AAGCTTCCACAGCGTGGAAGAGG - Intronic
952971113 3:38650825-38650847 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
953119769 3:40028165-40028187 CAGCTCTGACAGGTTGTTAGAGG - Intronic
953582852 3:44172830-44172852 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
953606569 3:44416662-44416684 CAGCACCCTCAGCTTGGAACTGG - Intergenic
953623271 3:44550626-44550648 AAGCTTCCACAGCATGGAAGGGG + Intergenic
953632322 3:44629461-44629483 CAGCTCCATCACCCTGGAAGTGG + Exonic
954089181 3:48271277-48271299 AAGCTTCCACAGCATGGAAGGGG + Intronic
954107195 3:48415747-48415769 CTGCTCCGGCAGCCTGGGAGGGG + Exonic
954599451 3:51856650-51856672 AAGCTTCCACAGCATGGAAGGGG - Intergenic
955090935 3:55749762-55749784 AAGCTTCCACAGCGTGGAAGGGG - Intronic
955106250 3:55901408-55901430 CAACTCCATGAGCTTGGAAGAGG - Intronic
955493957 3:59511759-59511781 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
955537525 3:59940060-59940082 CAGGTCCCACAGCTGGAAAGTGG - Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
956842426 3:73153084-73153106 AAGCTTCCATAGCTTGGAAGGGG + Intergenic
956843313 3:73159401-73159423 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
956855398 3:73269999-73270021 AAGCTCCCACAGTGTGGAAGGGG - Intergenic
957074217 3:75588614-75588636 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
957445911 3:80312581-80312603 CAGCTTCCACAGCATGGAAGGGG - Intergenic
957604112 3:82375814-82375836 CCTGTCTGACAGCTTGGAAGAGG - Intergenic
957919794 3:86732670-86732692 AAGCTTCCACAGCATGGAAGGGG + Intergenic
958601726 3:96302719-96302741 AAGCTTCCACAGCATGGAAGGGG - Intergenic
959334410 3:105045966-105045988 AAGCTTCCACAGCATGGAAGGGG - Intergenic
959414889 3:106072108-106072130 AAGCTTCTACAGCATGGAAGGGG - Intergenic
959564308 3:107818757-107818779 AAGCTTCCACAGCATGGAAGGGG - Intergenic
959608983 3:108273069-108273091 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
960063356 3:113346840-113346862 AAGCTTCCACAGCATGGAAGGGG - Intronic
960064121 3:113352320-113352342 AAGCTTCCACAGCATGGAAGGGG - Intronic
960327680 3:116317152-116317174 AAGCTTCCACAGCGTGGAAGGGG - Intronic
960868436 3:122226472-122226494 AAGCTTCCACAGCGTGGAAGGGG + Intronic
961746583 3:129067816-129067838 AACCTCCAACAGCGTGGAAGCGG + Intergenic
962297072 3:134200151-134200173 AAGCTTCCACAGCGTGGAAGGGG - Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
963021772 3:140878711-140878733 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
963692792 3:148525687-148525709 AAGCTTCCACAGCATGGAAGGGG - Intergenic
963696391 3:148570910-148570932 AAGCTTCCACAGCATGGAAGGGG - Intergenic
963700331 3:148618101-148618123 AAGCTTCCACAGCATGGAAGGGG - Intergenic
964083647 3:152790001-152790023 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
964184286 3:153924054-153924076 AAGCTTCCACAGCTTGGAAGGGG + Intergenic
964392119 3:156208546-156208568 CATCTCTGACAACTTGGAGGGGG + Intronic
964424891 3:156541888-156541910 CACATCCGATAGCATGGAAGTGG + Exonic
964604888 3:158549960-158549982 AAGCTTCCACAGCATGGAAGGGG + Intergenic
964916280 3:161846081-161846103 AAGCTTCCACAGCATGGAAGGGG + Intergenic
965102114 3:164311103-164311125 AAGCTTCCACAGCATGGAAGGGG + Intergenic
965288189 3:166843687-166843709 AAGCTCCCACAGTGTGGAAGGGG - Intergenic
965443556 3:168746283-168746305 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
965605779 3:170496477-170496499 CAGCTCCGACCGCTTGGCGCTGG - Intronic
966315741 3:178643827-178643849 CAGCTCTGAGAACTGGGAAGTGG - Intronic
966529743 3:180962925-180962947 CAGCTGCGACAGATTGGTATGGG + Exonic
967576881 3:191104909-191104931 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
968626985 4:1630172-1630194 CAGCTCCGACAGCTTGGAAGGGG - Intronic
968709367 4:2101957-2101979 CAGCTGTGACAGCTGGGATGGGG + Intronic
969321787 4:6417079-6417101 CAGCACCGGCAGCTGGGCAGTGG + Intronic
969702589 4:8775921-8775943 AAGCTCCGACAGCTGTGATGGGG + Intergenic
970035035 4:11723644-11723666 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
970649184 4:18158786-18158808 AAGCTCCCACAGCGTGAAAGGGG + Intergenic
970700447 4:18730648-18730670 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
970811132 4:20095372-20095394 CAGAGTTGACAGCTTGGAAGAGG - Intergenic
971533709 4:27721546-27721568 AAGCTTCTACAGCATGGAAGGGG + Intergenic
971630569 4:28987926-28987948 AAGCTTCCACAGCATGGAAGGGG + Intergenic
971793892 4:31202013-31202035 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
971869502 4:32216684-32216706 CCGCTCCTCCAACTTGGAAGGGG + Intergenic
971980124 4:33741225-33741247 AAGCTTCCACAGCATGGAAGAGG - Intergenic
972034666 4:34506184-34506206 AAGCTCCCACAGTGTGGAAGGGG + Intergenic
972132778 4:35859073-35859095 AAGCTTCCACAGCATGGAAGGGG + Intergenic
972197340 4:36670064-36670086 TAGCTCAGACAGCTGGGAGGTGG + Intergenic
973039804 4:45456483-45456505 AAGCTCCCACAGCATGGAAGGGG + Intergenic
973308214 4:48676191-48676213 CAGCTTCCACAGTGTGGAAGGGG - Intronic
973854243 4:54994361-54994383 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
974188100 4:58465980-58466002 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
974520326 4:62974255-62974277 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
974520968 4:62979228-62979250 AAGCTTCCACAGCATGGAAGGGG + Intergenic
974526204 4:63052888-63052910 AAGCTTCCACAGCATGGAAGGGG - Intergenic
974534142 4:63153159-63153181 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
974645711 4:64688431-64688453 AAGCTTCCACAGCATGGAAGGGG - Intergenic
974735172 4:65921196-65921218 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
974969406 4:68805525-68805547 AAGCTTCCACAGCGTGGAAGTGG - Intergenic
974972084 4:68842923-68842945 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
975001219 4:69224799-69224821 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
975004219 4:69267485-69267507 AAGCTTCCACAGCATGGAAGGGG - Intergenic
975013382 4:69381491-69381513 AAGCTTCCACAGCATGGAAGGGG - Intronic
975033845 4:69657543-69657565 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
975202371 4:71607020-71607042 AAGCTTCCACAGCTTGGAAGAGG + Intergenic
975208341 4:71669909-71669931 AAGCTTCCACAGCATGGAAGGGG - Intergenic
975693595 4:76990027-76990049 AAGCTTCCACAGCGTGGAAGGGG + Intronic
975745088 4:77467335-77467357 AAGCTCCCACAGTGTGGAAGGGG - Intergenic
977024481 4:91798716-91798738 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
977250791 4:94686437-94686459 AAGCTTCCACAGCATGGAAGGGG - Intergenic
977370234 4:96126040-96126062 AAGCTACCACAGCATGGAAGGGG + Intergenic
977449920 4:97182348-97182370 AAGCTTCCACAGCATGGAAGGGG - Intergenic
978144761 4:105359378-105359400 AAGCTTCCACAGCCTGGAAGGGG - Intergenic
978787260 4:112624103-112624125 AAGCTTCCACAGCGTGGAAGGGG - Intronic
979235278 4:118392916-118392938 AAGCTTCCACAGCATGGAAGAGG - Intergenic
979953358 4:126922925-126922947 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
980291228 4:130849051-130849073 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
980660323 4:135849525-135849547 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
982486162 4:155968271-155968293 AAGTTCCCACAGCTTGGAAGGGG + Intergenic
982488821 4:156002297-156002319 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
982630304 4:157822572-157822594 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
982700765 4:158657962-158657984 AAGCTTCCACAGCATGGAAGGGG - Intergenic
982701829 4:158665439-158665461 AAGCTTCCACAGCATGGAAGGGG - Intergenic
982773054 4:159415614-159415636 AAGCTTCCACAGCATGGAAGGGG - Intergenic
983014822 4:162600276-162600298 AAGCTTCCACAGCGTGGAAGTGG + Intergenic
983026247 4:162740508-162740530 AAGCTCGCACAGCGTGGAAGGGG - Intergenic
983084698 4:163428500-163428522 AAGCTTCCACAGCATGGAAGGGG - Intergenic
983207869 4:164930315-164930337 AAGCTCCCACAGTGTGGAAGGGG + Intergenic
983230522 4:165125453-165125475 AAGCTTCCACAGCCTGGAAGGGG + Intronic
984293966 4:177830447-177830469 AAGCTTCCACAGCATGGAAGGGG - Intronic
984324253 4:178231386-178231408 CAGCTTCCACAGGATGGAAGGGG - Intergenic
984728810 4:183046256-183046278 AAGCTTCCACAGCGTGGAAGAGG - Intergenic
984938972 4:184915124-184915146 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
985553561 5:545263-545285 TAGCTTCCACAGCATGGAAGGGG - Intergenic
986152138 5:5138595-5138617 AAGCTTCCACAGCATGGAAGGGG - Intergenic
986420270 5:7573662-7573684 AAGCTTCCACAGCGTGGAAGGGG + Intronic
986661895 5:10066456-10066478 CAGCTTCCACTGCGTGGAAGGGG - Intergenic
986929192 5:12796557-12796579 AAGCCCCCACAGCATGGAAGGGG - Intergenic
987467204 5:18285958-18285980 AAGCTTCCACAGCCTGGAAGGGG - Intergenic
987923298 5:24310715-24310737 CAGCTTCCACAGCATAGAAGGGG - Intergenic
987938319 5:24498978-24499000 AAGCTTCCACAGCGTGGAAGGGG + Intronic
987987248 5:25163099-25163121 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
988039919 5:25875965-25875987 AAGCTTCCACAGCATGGAAGGGG + Intergenic
988113420 5:26852765-26852787 AAGCTTCCACAGCATGGAAGGGG - Intergenic
988358407 5:30204958-30204980 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
988619130 5:32804537-32804559 AAGCTTCCACAGCATGGAAGGGG + Intergenic
989281783 5:39652784-39652806 AAGCTTCCACAGCCTGGAAGGGG + Intergenic
989678973 5:44007072-44007094 AAGCTTCCATAGCTTGGAAGGGG + Intergenic
989756283 5:44959335-44959357 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
989964003 5:50448296-50448318 AAGCTTCCACAGCATGGAAGGGG + Intergenic
990043754 5:51403014-51403036 AAGCTTCCACAGCATGGAAGGGG - Intergenic
990165438 5:52989128-52989150 CAGCCCCGGCAGCCTGGAGGCGG - Intergenic
990311695 5:54546038-54546060 CAGATACAACAGCTTGGACGGGG - Intronic
990367297 5:55084409-55084431 AAGCTTCCACAGCATGGAAGGGG + Intergenic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
991025994 5:62030441-62030463 CAACTACGTGAGCTTGGAAGTGG - Intergenic
991468747 5:66944768-66944790 CAGCCAGGAGAGCTTGGAAGAGG - Intronic
992455814 5:76914509-76914531 AAGCTTCCACAGCATGGAAGGGG - Intronic
992545431 5:77810310-77810332 AAGCTCCCACAGCGTGGAAGGGG - Intronic
994230797 5:97309156-97309178 AAGCTTCCACAGCATGGAAGGGG + Intergenic
994935408 5:106246991-106247013 AAGCTTCTACAGCGTGGAAGAGG - Intergenic
995032450 5:107495118-107495140 AAGCTTCCACAGCGTGGAAGGGG - Intronic
995583800 5:113625837-113625859 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
995707444 5:114999806-114999828 AAGCTTCCACAGCATGGAAGGGG - Intergenic
995988328 5:118207656-118207678 AAGCTTCCACAGCGTGGAAGCGG + Intergenic
996272046 5:121617227-121617249 AAGCTGCCACAGCATGGAAGGGG - Intergenic
997028945 5:130099830-130099852 CAGCTCTGAAAGCTCGGTAGAGG - Intronic
997072044 5:130633658-130633680 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
997772098 5:136564736-136564758 AAGCTTCCACAGCATGGAAGGGG - Intergenic
998391672 5:141790869-141790891 AAGCTCCCACAGCTGGAAAGTGG + Intergenic
998846503 5:146315550-146315572 CAGGTCACACAGCCTGGAAGAGG + Intronic
999280785 5:150364197-150364219 CACCTCGGAGAGCTCGGAAGAGG + Exonic
999348699 5:150846537-150846559 AAGCTTCCACAGCATGGAAGGGG - Exonic
999417025 5:151407184-151407206 AAGCTTCCACAGCTTGGAAGGGG + Intergenic
999445506 5:151635534-151635556 AAGCTTCTACAGCATGGAAGGGG - Intergenic
999658611 5:153834983-153835005 CAGCTCTGACAGCTGGAAAGTGG - Intergenic
1000541661 5:162548726-162548748 AAGCTTCCACAGCCTGGAAGGGG - Intergenic
1000785276 5:165535330-165535352 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1000842479 5:166238307-166238329 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1001497244 5:172197777-172197799 AAGCTCCTACAGCATGAAAGGGG + Intronic
1001611601 5:173007307-173007329 CAGCCACGAGAGCTTGGAAGAGG - Intronic
1002130690 5:177079779-177079801 GAGGACCGACAGCTGGGAAGTGG - Intronic
1002556417 5:180045503-180045525 AAGCTCCCACAGCGCGGAAGTGG + Intronic
1003249611 6:4414481-4414503 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1003794098 6:9580732-9580754 CAGCCCTGAAACCTTGGAAGAGG + Intergenic
1003833421 6:10040499-10040521 AAGCTTCCACAGCGTGGAAGGGG - Intronic
1004182799 6:13395537-13395559 GAGCTCACACAGCTAGGAAGGGG - Intronic
1004532282 6:16464449-16464471 AAGCTTCCACAGCGTGGAAGGGG - Intronic
1004811878 6:19271342-19271364 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1005114136 6:22317881-22317903 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1005649950 6:27877361-27877383 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1005712150 6:28512644-28512666 AAGCTCCCACAGTGTGGAAGGGG - Intronic
1006226307 6:32539456-32539478 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1006900974 6:37500891-37500913 AAGCTCCCACATCATGGAAGGGG + Intergenic
1006963955 6:37962775-37962797 AAGCTTCCACAGCGTGGAAGGGG - Intronic
1007029686 6:38616779-38616801 AAGCTTCCACAGCGTGGAAGGGG - Intronic
1007048091 6:38797818-38797840 AAGCTTCCACAGCGTGGAAGGGG - Intronic
1007369481 6:41416981-41417003 CAGATCCCACAGCTTGAAAGAGG + Intergenic
1007992642 6:46273131-46273153 CGGTTCCAACATCTTGGAAGTGG + Intronic
1008230696 6:48982958-48982980 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1008270071 6:49481548-49481570 AAGCTTCCACAGCATGGAAGGGG + Intronic
1008630982 6:53362846-53362868 AAGCTTCCACAGCCTGGAAGGGG + Intergenic
1008977186 6:57441221-57441243 CAGCTCTGGCAGCTAGCAAGGGG - Intronic
1009165319 6:60334168-60334190 CAGCTCTGGCAGCTAGAAAGGGG - Intergenic
1009241809 6:61193932-61193954 CAGCCCCAACAACTTGGAAGAGG + Intergenic
1009327395 6:62369956-62369978 AAGCTTCCACAGCTTGGAAGGGG - Intergenic
1009667628 6:66704526-66704548 CAGCTCCCACAGTGTGGAAGAGG + Intergenic
1009687989 6:66988052-66988074 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1009946626 6:70348012-70348034 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1010074601 6:71785613-71785635 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1011246690 6:85327052-85327074 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1011373326 6:86663983-86664005 AACCTTCCACAGCTTGGAAGGGG - Intergenic
1011374127 6:86672192-86672214 AACCTTCCACAGCTTGGAAGGGG + Intergenic
1011375386 6:86681214-86681236 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1012440919 6:99261696-99261718 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1012551695 6:100469382-100469404 CAGCTCCGAACGCGGGGAAGCGG + Intergenic
1012598348 6:101066048-101066070 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1012739687 6:103000599-103000621 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1013080357 6:106806555-106806577 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1013113733 6:107084935-107084957 AAGCTTCCACAGCGTGGAAGGGG - Intronic
1013668941 6:112377043-112377065 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1013906907 6:115231904-115231926 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1013908209 6:115241091-115241113 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1013977071 6:116091386-116091408 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1013977804 6:116096779-116096801 AAGCTTCCACAGCATGGAAGAGG - Intergenic
1014201871 6:118617647-118617669 AAGCTTCCACAGCATGGAAGGGG - Intronic
1014969105 6:127792047-127792069 CAGCTCCTCCAACTTGGAAGGGG + Intronic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1015665692 6:135626055-135626077 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1016092686 6:139999097-139999119 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1016184745 6:141184031-141184053 AAGCTTCCACAGCGTGGAAGCGG - Intergenic
1016248403 6:142015217-142015239 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1016283864 6:142450916-142450938 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1017100936 6:150849352-150849374 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1017353187 6:153469103-153469125 AAGCTCCCACAGTATGGAAGGGG + Intergenic
1017380397 6:153821683-153821705 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1018574456 6:165244788-165244810 CAGCTCCTGCAGCCAGGAAGTGG - Intergenic
1019115535 6:169758441-169758463 CACGTCAGACAGCTAGGAAGTGG + Intronic
1019618217 7:1976584-1976606 AAGCTCCCACAGCGTGGAAGGGG + Intronic
1019944111 7:4313332-4313354 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1019965599 7:4496322-4496344 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1020761116 7:12269328-12269350 CTGCCCTGCCAGCTTGGAAGGGG - Intergenic
1021094566 7:16521069-16521091 CAGATGAGGCAGCTTGGAAGTGG - Intronic
1021347870 7:19549564-19549586 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1021572367 7:22079184-22079206 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1021778590 7:24079051-24079073 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1022148566 7:27574256-27574278 CAGATCCCACAGCTTAGAAAAGG + Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1023546055 7:41318573-41318595 AAGCTACCACAGCATGGAAGGGG + Intergenic
1024265584 7:47603851-47603873 AAGCTTCTACAGCCTGGAAGGGG - Intergenic
1024285311 7:47752024-47752046 AAGCTTCCACAGCATGGAAGGGG - Intronic
1024331888 7:48163053-48163075 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1024681511 7:51694263-51694285 CAGCCCGGACTGCTTGGATGTGG - Intergenic
1024734942 7:52295201-52295223 AAGCTCCCACAGCATGGAAGAGG - Intergenic
1024790165 7:52956896-52956918 AAGCTTCCACAGCTTGGAAAGGG - Intergenic
1024871151 7:53962729-53962751 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1026379675 7:69786518-69786540 AAGCTTCCACAGCATGGAAGAGG - Intronic
1026486102 7:70822827-70822849 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1027665008 7:81034304-81034326 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1027790756 7:82637158-82637180 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1027791964 7:82645632-82645654 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1028913114 7:96229500-96229522 AAGCTTCCACAGCGTGGAAGGGG - Intronic
1029988298 7:104940960-104940982 AAGCTCCCACAGCCCGGAAGGGG - Intergenic
1030010882 7:105165783-105165805 AAGCTTCCACAGCATGGAAGGGG - Intronic
1030366871 7:108656651-108656673 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1030420854 7:109304520-109304542 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1030843566 7:114383314-114383336 CTCCTCCCACTGCTTGGAAGGGG + Intronic
1031471450 7:122173453-122173475 CTCCTCCCACAGTTTGGAAGGGG - Intergenic
1031732401 7:125315157-125315179 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1033393945 7:140956347-140956369 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1033423214 7:141220722-141220744 CAGCTTCTGCAGATTGGAAGTGG + Intronic
1033649405 7:143329450-143329472 CAGCTGCTACAGTTTGGCAGAGG - Intronic
1033857743 7:145585426-145585448 AAGCTTCTACAGCGTGGAAGGGG - Intergenic
1033979746 7:147148999-147149021 CATCTTCCACAGCATGGAAGGGG + Intronic
1034155167 7:148950048-148950070 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1034579236 7:152028138-152028160 AAGCTTCCACAGCATGGAAGGGG + Intronic
1034724912 7:153326521-153326543 CAGCTACAACAGTTTGGAACTGG - Intergenic
1036099069 8:5757516-5757538 AAGCTCCCACAGCTTGGAAGGGG + Intergenic
1036915114 8:12797070-12797092 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1037173830 8:15924391-15924413 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1037373278 8:18202809-18202831 AAGCTTCCACAGCGTGGAAGGGG + Intronic
1037571511 8:20161922-20161944 CAGTTCCGTGATCTTGGAAGTGG + Intronic
1038012992 8:23489513-23489535 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1038430006 8:27492606-27492628 AAGCTTCCACAGCATGGAAGGGG + Intronic
1039693512 8:39885247-39885269 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1040526824 8:48233102-48233124 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1040999512 8:53437076-53437098 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1041000284 8:53442792-53442814 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1041001534 8:53459643-53459665 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1041034512 8:53775335-53775357 CAGCTCCCACAGTGTGGAAGGGG + Intronic
1041357421 8:57014813-57014835 CTGCTCCACCAACTTGGAAGGGG + Intergenic
1041818710 8:62004185-62004207 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1041919073 8:63162914-63162936 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1042040065 8:64580868-64580890 CACCTCCAAGCGCTTGGAAGCGG + Exonic
1042443093 8:68850560-68850582 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1042597904 8:70469471-70469493 AAGCTCCCGCAGCTTGTAAGTGG + Intergenic
1042771572 8:72388321-72388343 AAGCTTCCACAGCTTGGAAGGGG - Intergenic
1042772580 8:72395396-72395418 AAGCTTCCACAGCCTGGAAGGGG - Intergenic
1042823171 8:72953798-72953820 CAGCTCTGACTGCCTGGTAGTGG - Intergenic
1042919266 8:73906347-73906369 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1042920389 8:73913864-73913886 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1043435521 8:80233133-80233155 CAGCTTCCACAGCGTGGAAAGGG - Intergenic
1043703379 8:83318918-83318940 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1044008806 8:86966819-86966841 AAGCTTCCACAGCATGGAAGAGG + Intronic
1044213069 8:89573455-89573477 GAACTCAGACACCTTGGAAGAGG + Intergenic
1044412674 8:91901882-91901904 CTGCTCTGCCAACTTGGAAGGGG + Intergenic
1044441598 8:92230759-92230781 CAGCTCCCTCAGCTTGCAGGGGG + Intergenic
1044455955 8:92393457-92393479 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1044459517 8:92428688-92428710 CAGCTTCCACAGCTTGGAATGGG + Intergenic
1044679090 8:94759154-94759176 AAGCTTCCACAGCATGGAAGGGG + Intronic
1044880535 8:96718599-96718621 AAGCTTCCACAGCGTGGAAGGGG + Intronic
1045399865 8:101802839-101802861 AAGCTTCCACAGCGTGGAAGGGG - Intronic
1045589002 8:103572259-103572281 AAGCTTCCACAGCATGGAAGGGG + Intronic
1045678274 8:104632259-104632281 AAGCTCCCACAACGTGGAAGGGG + Intronic
1045830845 8:106458576-106458598 CAGTTCTGAGATCTTGGAAGTGG - Intronic
1045858928 8:106793934-106793956 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1045928427 8:107597519-107597541 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1046329734 8:112699125-112699147 AAGCTTCCACAGCATGGAAGGGG - Intronic
1046337810 8:112813204-112813226 AAGCTCCCACAGCATGGAAGGGG + Intronic
1046621342 8:116531852-116531874 AAGCTCCCACAGCGTGGAAGGGG - Intergenic
1047739879 8:127797910-127797932 CAGGTCACACAGCTTGGGAGAGG + Intergenic
1048193174 8:132308822-132308844 GAGCTCCCACAGCTAGAAAGTGG + Intronic
1048210425 8:132450105-132450127 AAGCTTCCACAGCATGGAAGGGG + Intronic
1049827108 8:144676118-144676140 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1050835424 9:10072503-10072525 CAGCTTCCACAGCATGGAAGGGG + Intronic
1050923492 9:11234818-11234840 CACCTCCGACTGCTTGCAATGGG - Intergenic
1051549622 9:18314722-18314744 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1051935906 9:22441565-22441587 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1052058161 9:23925870-23925892 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1053860144 9:42378432-42378454 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1054900468 9:70363771-70363793 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1055458628 9:76495445-76495467 GAGCTTCCACAGCATGGAAGGGG + Intronic
1055951155 9:81730920-81730942 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1056391817 9:86147820-86147842 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1056736081 9:89210352-89210374 CAGCTTCCACAGCGTTGAAGGGG - Intergenic
1056846402 9:90041487-90041509 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1057343520 9:94225759-94225781 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1058510588 9:105713073-105713095 CAGCCCCACCAACTTGGAAGGGG - Intronic
1059325982 9:113504247-113504269 CAGCTCAGCAAGCTTGGAAAAGG - Intronic
1059681416 9:116590144-116590166 CCGCTCCTCCAACTTGGAAGTGG - Intronic
1060252526 9:121997625-121997647 AAGGTCCTACAGCTAGGAAGTGG - Intronic
1060472348 9:123958727-123958749 AAGCTCACACAGCTAGGAAGTGG + Intergenic
1062032389 9:134367582-134367604 CTGCACCGACAGCTTGGCCGAGG - Intronic
1203415408 Un_KI270582v1:2116-2138 CCTCTCTGACAGCTTTGAAGAGG - Intergenic
1186465841 X:9784411-9784433 AAGCTTCCACAGCATGGAAGGGG + Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1188176939 X:27002432-27002454 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1188242815 X:27810148-27810170 AAGCTTCCACAGTTTGGAAGGGG - Intronic
1188248037 X:27857462-27857484 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1188612492 X:32117571-32117593 CAGCTCGAAGAGGTTGGAAGGGG - Intronic
1188976662 X:36683625-36683647 CAGCCCTGAGAGTTTGGAAGCGG + Intergenic
1190325686 X:49205618-49205640 CAGTGCCGACAGCTTGGTGGAGG - Exonic
1191863996 X:65689355-65689377 CAGCTCCAAAAAGTTGGAAGTGG + Intronic
1193145723 X:78073740-78073762 AAGCTTCCACAGCGTGGAAGGGG + Intronic
1193462283 X:81805866-81805888 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1193463010 X:81811947-81811969 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1193850834 X:86535752-86535774 AAGCTTCCACAGCCTGGAAGGGG + Intronic
1193941034 X:87681266-87681288 AAGCTCCCACAGCATGGAAGGGG - Intergenic
1193951634 X:87808198-87808220 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1194204604 X:90996315-90996337 AAGCTCCCACAGTGTGGAAGGGG - Intergenic
1194794779 X:98198233-98198255 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1195439179 X:104882732-104882754 AAGCTTCTACAGCATGGAAGGGG - Intronic
1195551918 X:106181247-106181269 AAGCTTCCACAGCGTGGAAGGGG + Intronic
1195579949 X:106490180-106490202 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1195621619 X:106961763-106961785 AAGCTTCCACAGCTTGGAAGGGG - Intronic
1195643042 X:107198411-107198433 AAGCTTCCACAGCCTGGAAGGGG - Intronic
1195850567 X:109277887-109277909 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1196108327 X:111919360-111919382 AAGCTTCCACAGCATGGAAGGGG - Intronic
1196127705 X:112116424-112116446 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1196419892 X:115510573-115510595 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1196681192 X:118471627-118471649 AAGCTTCCACAGCATGGAAGTGG - Intergenic
1196853005 X:119956535-119956557 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1196926927 X:120642577-120642599 CAGGTCACACAGCTAGGAAGTGG - Intergenic
1197209433 X:123816719-123816741 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1197331037 X:125154978-125155000 AAGCTCCCACAGCGTGGAAGGGG + Intergenic
1197513024 X:127395091-127395113 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1197649884 X:129052905-129052927 CAGTTAAGACAGCTTGGAAAAGG + Intergenic
1199028631 X:142971334-142971356 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1199094688 X:143725488-143725510 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1199284979 X:146045715-146045737 AAGCTCCCACAGCATAGAAGTGG + Intergenic
1199554014 X:149086974-149086996 AAGCTTCCACAGCCTGGAAGGGG + Intergenic
1199753697 X:150845188-150845210 CAGCTCTGACTTCTTGGAAAAGG - Intronic
1200139224 X:153890158-153890180 AAGCTTCCACAGCATGGAAGAGG + Intronic
1200145915 X:153926478-153926500 CTGCTCCGGCTGCTTGGCAGCGG - Intronic
1200363959 X:155641520-155641542 AAGCTTCCACAGCGTGGAAGGGG + Intronic
1200470761 Y:3583605-3583627 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1200550446 Y:4571757-4571779 AAGCTCCCACAGTGTGGAAGGGG - Intergenic
1200694529 Y:6347185-6347207 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1200711726 Y:6490676-6490698 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1200749382 Y:6930832-6930854 AAGCTGCCACAGCATGGAAGGGG - Intronic
1200750330 Y:6939028-6939050 AAGCTGCCACAGCATGGAAGGGG + Intronic
1200776925 Y:7177601-7177623 AAGCTTCCACAGCATGGAAGAGG - Intergenic
1200829629 Y:7678355-7678377 CAGCTCTGCCTGCTTGGGAGAGG + Intergenic
1201022210 Y:9671304-9671326 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1201040748 Y:9827525-9827547 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1201279142 Y:12326016-12326038 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1201285342 Y:12374522-12374544 AAGCTTCCACAGCATGGAAGCGG + Intergenic
1201344379 Y:12966907-12966929 CTGCCCTGACAGCTAGGAAGAGG - Intergenic
1201404634 Y:13637112-13637134 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1201429315 Y:13888950-13888972 AAGCTTCCACAGCGTGGAAGGGG - Intergenic
1201568057 Y:15386797-15386819 AAGCTTCCACAGCATGGAAGTGG + Intergenic
1201583711 Y:15537519-15537541 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1201652916 Y:16310815-16310837 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1201676854 Y:16595606-16595628 AAGCTCCCACAGAATGGAAGTGG - Intergenic
1201728909 Y:17185162-17185184 AAGCTTCCACAGCGTGGAAGGGG + Intergenic
1201744312 Y:17353784-17353806 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1201750297 Y:17423962-17423984 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1201910801 Y:19131897-19131919 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1201913316 Y:19155893-19155915 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1201981383 Y:19913803-19913825 AAGCTTCCACAGCATGGAAGGGG + Intergenic
1201985687 Y:19962390-19962412 AAGCTCCCACAGCATGGAAGGGG + Intergenic
1202242517 Y:22786179-22786201 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1202243765 Y:22795376-22795398 AAGCTCCCACAGAATGGAAGGGG - Intergenic
1202395502 Y:24419928-24419950 AAGCTTCCACAGCATGGAAGGGG - Intergenic
1202396752 Y:24429126-24429148 AAGCTCCCACAGAATGGAAGGGG - Intergenic
1202474031 Y:25240966-25240988 AAGCTCCCACAGAATGGAAGGGG + Intergenic
1202475282 Y:25250164-25250186 AAGCTTCCACAGCATGGAAGGGG + Intergenic