ID: 968627006

View in Genome Browser
Species Human (GRCh38)
Location 4:1630264-1630286
Sequence CCTGGTCACGGGCAGCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968627006_968627014 -4 Left 968627006 4:1630264-1630286 CCTCTGAGCTGCCCGTGACCAGG 0: 1
1: 0
2: 3
3: 10
4: 184
Right 968627014 4:1630283-1630305 CAGGGGGTCAGAGCCCACCTTGG 0: 1
1: 0
2: 2
3: 30
4: 383
968627006_968627015 4 Left 968627006 4:1630264-1630286 CCTCTGAGCTGCCCGTGACCAGG 0: 1
1: 0
2: 3
3: 10
4: 184
Right 968627015 4:1630291-1630313 CAGAGCCCACCTTGGTGTTGTGG No data
968627006_968627019 13 Left 968627006 4:1630264-1630286 CCTCTGAGCTGCCCGTGACCAGG 0: 1
1: 0
2: 3
3: 10
4: 184
Right 968627019 4:1630300-1630322 CCTTGGTGTTGTGGCCCCCATGG 0: 1
1: 0
2: 0
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968627006 Original CRISPR CCTGGTCACGGGCAGCTCAG AGG (reversed) Intronic
900156595 1:1205706-1205728 CCTGGGCAGGGGCAGCTGTGGGG - Intronic
900503606 1:3018422-3018444 CCGGGGCACTGGCAGCACAGTGG - Intergenic
900893035 1:5463426-5463448 CCTGGGCAATGGCAGCTCACTGG + Intergenic
901104420 1:6744097-6744119 CCCAGGCAGGGGCAGCTCAGTGG - Intergenic
901326116 1:8366144-8366166 GCAGTCCACGGGCAGCTCAGTGG - Intronic
902503539 1:16925646-16925668 CCTGGACAAGTCCAGCTCAGGGG - Intronic
902877145 1:19347508-19347530 CCTGGTCAGGGTCAGCTCGCTGG + Intronic
902877560 1:19349881-19349903 CCTGGTCAGGGTCGGCTCGGTGG + Intronic
905522647 1:38612316-38612338 TCTGGCCAGGGGCAGCTCAGGGG - Intergenic
908251836 1:62271952-62271974 TCTGCTCAAGGGCACCTCAGTGG + Intronic
910730593 1:90391806-90391828 CCAGGCCACAGGCAGCCCAGAGG + Intergenic
911430018 1:97773739-97773761 CCTGGAGTTGGGCAGCTCAGTGG - Intronic
912002779 1:104856087-104856109 CCTGGAATCGGGCCGCTCAGTGG + Intergenic
912682795 1:111739591-111739613 CCTGGTCCCGGCCAGCGCGGCGG + Intronic
914001036 1:143694639-143694661 AATGGACAAGGGCAGCTCAGAGG - Intergenic
914095164 1:144539096-144539118 CCTGGGCTCGGGCACCTCCGAGG - Intergenic
914303358 1:146394800-146394822 CCTGGGCTCGGGCACCTCCGAGG + Intergenic
914918234 1:151831188-151831210 CGTGGTCATGGGCAGCTGACAGG + Intronic
917411787 1:174766748-174766770 CCTTGACAAGGGCATCTCAGAGG + Intronic
917554245 1:176067551-176067573 CCTGGAGTCGGGCCGCTCAGTGG - Intronic
917639491 1:176969213-176969235 CCTGCTTACAGGCATCTCAGAGG - Intronic
920380995 1:205534498-205534520 CCTGGTCCCTGGGAGCCCAGTGG - Intergenic
922994454 1:229944669-229944691 CTTGGTCAGGGCCGGCTCAGAGG - Intergenic
1063319472 10:5039319-5039341 CCTGGTCACGGCCAGGAAAGGGG - Intronic
1064107611 10:12513249-12513271 CCTGGACGCGGGCAGCCCTGGGG + Intronic
1065371508 10:24991602-24991624 CCTGGAGCCGGGCAGCTCTGTGG - Intronic
1066214977 10:33277447-33277469 CCTGATCACGGGCAGCCCCAAGG + Intronic
1067709427 10:48636444-48636466 CCTGGGCAGGAGCAGCCCAGTGG - Intronic
1068309758 10:55262633-55262655 CCTGGAGTCGGGCTGCTCAGTGG - Intronic
1069959444 10:72070987-72071009 CTTGGTCACGGGCCACTCTGTGG - Intronic
1070891773 10:79946530-79946552 CCTGGTCATGTGTAGCTCAGTGG - Exonic
1072718661 10:97767651-97767673 CCTGGTCATGGGCCGCAAAGTGG - Exonic
1076652010 10:131996507-131996529 GCTGGGAACTGGCAGCTCAGGGG + Intergenic
1077460449 11:2706631-2706653 CCTTGTCAGGGGCAGCAAAGTGG + Intronic
1077476849 11:2794502-2794524 CGTGGTCAGGGGCGGCACAGGGG + Intronic
1078474639 11:11620584-11620606 CCCGGTCCCGGGCGGCTCCGCGG + Intronic
1078604978 11:12767109-12767131 CCAAGTCACAGGCAGGTCAGAGG - Intronic
1081594821 11:44451954-44451976 CCTACTCAGGGGCAGCTCAGGGG - Intergenic
1084216554 11:67650051-67650073 CCTGGCCAAGGGCAGCTGTGGGG + Intronic
1084643311 11:70438834-70438856 CCTGGCCAGGGGCCTCTCAGAGG + Intergenic
1085711155 11:78830275-78830297 CCTGGTCATGGGCACCACCGAGG - Intronic
1086916084 11:92531529-92531551 CCTGGGCAGAGGCAGCTCAGAGG + Intronic
1088231578 11:107678512-107678534 CCTGGTCAGCGCCAGCCCAGGGG - Intergenic
1092116934 12:6016128-6016150 CCTGGTCACGGACGTCTCTGTGG - Exonic
1092140306 12:6179111-6179133 CCTGGTCAGAGGCTGGTCAGAGG + Intergenic
1095518990 12:43039264-43039286 CCTCTTCAAAGGCAGCTCAGAGG - Intergenic
1097337169 12:58395873-58395895 CCTGCCCACAGCCAGCTCAGGGG + Intergenic
1100724568 12:97395156-97395178 CCTACTCCCAGGCAGCTCAGAGG + Intergenic
1106313431 13:28573808-28573830 CTTGCTCACGGGCAGCTGGGAGG + Intergenic
1107531791 13:41289558-41289580 ACTGGTGACAGTCAGCTCAGTGG + Intergenic
1108522596 13:51259407-51259429 CAGGGTCACGGGCAGATGAGGGG - Intronic
1113803014 13:113096239-113096261 CCTGGCCACGACCAGCTCCGGGG - Intronic
1113905357 13:113817052-113817074 CCTGGGCCCGGGCACCTCTGGGG - Intergenic
1114083290 14:19219648-19219670 TCTGCCCCCGGGCAGCTCAGGGG - Intergenic
1115123993 14:29971218-29971240 CCTGGAGTTGGGCAGCTCAGCGG + Intronic
1115974544 14:38981934-38981956 CCTGGACATGTGTAGCTCAGGGG + Intergenic
1116135299 14:40915482-40915504 TCTGGACACAAGCAGCTCAGGGG - Intergenic
1116845488 14:49861593-49861615 CATGCTCAAGGACAGCTCAGTGG + Intergenic
1117478302 14:56118753-56118775 CCTGGTCCCGGGCAGCGGCGCGG + Intronic
1121600937 14:95202612-95202634 CCTGCACACGGGCACCTCACTGG - Intronic
1122399367 14:101458115-101458137 CCTGGTCATGGGCAACGCGGCGG - Intergenic
1122414225 14:101541104-101541126 CCTGGCCTCGGGCAGCCCTGAGG - Intergenic
1122780296 14:104140612-104140634 CCTGGTCACGGGCAGGCCAGGGG + Intronic
1124358711 15:29018603-29018625 CCTAGCCAGGGGCTGCTCAGTGG - Intronic
1125453427 15:39832749-39832771 CTTGGCTACGTGCAGCTCAGGGG + Intronic
1125731436 15:41894612-41894634 CCGGGCCACGGCCAGCTCTGTGG - Intergenic
1129234988 15:74218563-74218585 CCTTGGGACGGGCAGCCCAGCGG + Intergenic
1132596751 16:754922-754944 CCTGCTCACCGGCAGCACACGGG + Intronic
1132621506 16:870195-870217 CCTGGTCAGGGGCTACTGAGAGG + Intronic
1137766182 16:50979403-50979425 CCTGGTCACAGGTAAGTCAGAGG - Intergenic
1137940237 16:52676887-52676909 CCTGTTCTAGAGCAGCTCAGAGG + Intergenic
1140456445 16:75108361-75108383 CCTGGTTCCGGTCAGTTCAGAGG + Exonic
1141316084 16:82963786-82963808 CCTTGGCACGGGAAGCCCAGGGG + Intronic
1142300962 16:89257536-89257558 CCTGGACGCGGGCTGCTCGGCGG + Intergenic
1142472160 17:170525-170547 CCTGGGCCCAGGCAGCTCTGTGG + Intronic
1145062527 17:19742119-19742141 CCTGTACACGGGCAGCACGGGGG - Exonic
1147792305 17:43021432-43021454 CCTGGTCACATGCAGCCCCGTGG - Intronic
1148216316 17:45835702-45835724 TCTGGACATGGGCAGGTCAGTGG - Exonic
1150999014 17:70352095-70352117 CCTGGAGTCGGGCTGCTCAGTGG - Intergenic
1151943084 17:77304982-77305004 CCTGGTCCTGGGCAGCCCACCGG + Intronic
1152561125 17:81079279-81079301 CCTGGTCACAGGCAGTCCCGTGG + Intronic
1152626354 17:81389521-81389543 CCTGGTCACTGTCACCTCTGCGG - Intergenic
1152791998 17:82285316-82285338 ACTGGCCCCGGGAAGCTCAGTGG - Intergenic
1152825623 17:82462868-82462890 TTTGGTCATGGGCATCTCAGTGG + Intronic
1152942472 17:83180074-83180096 CCTCTGCACGGGGAGCTCAGCGG + Intergenic
1153752518 18:8247805-8247827 GCTGGTCAGGGGCAGCAGAGAGG - Intronic
1156318066 18:35989609-35989631 CTGGGTCACGTGCAGCTCACAGG + Intronic
1160722230 19:602837-602859 CCTGGGCTAGGGCAGCGCAGTGG + Intronic
1161012966 19:1968999-1969021 CATGGGCAGGGGCAGCTCGGTGG + Intronic
1161773360 19:6243279-6243301 CCTGGTCCTGGGCAGGGCAGGGG - Intronic
1162459644 19:10806918-10806940 CATTGTCACTAGCAGCTCAGGGG + Intronic
1162771059 19:12949536-12949558 CCAGGTCACAGGAAGCACAGGGG - Intronic
1164401383 19:27904552-27904574 CCTGGTGAAGGCCAGCACAGGGG - Intergenic
1165682628 19:37790622-37790644 CCAGGTCACGGGCAGCGCAGAGG - Intronic
1166276647 19:41758572-41758594 CCTGGTCTGGGGCAGCCAAGAGG + Intronic
1166753869 19:45178920-45178942 GCTGGTCCCGAGCAGCTCACGGG + Intronic
1167209825 19:48127240-48127262 CCTGTCCAGGGGCAGCTGAGGGG - Intronic
1167446735 19:49542508-49542530 CAAGGTCAGGGGCAGCTCTGGGG - Intronic
1168498755 19:56875833-56875855 CAGGGTCACGAGCATCTCAGGGG - Intergenic
926048024 2:9724499-9724521 CCTTGTCAGGGTGAGCTCAGTGG - Intergenic
926151314 2:10427094-10427116 CCGGCTCACGGGGAGCTCAGAGG + Exonic
927201311 2:20579641-20579663 CAGGGTCCCAGGCAGCTCAGTGG - Intronic
927510504 2:23641312-23641334 CCTGGGCACGGCCAGCCCTGGGG - Intronic
929548711 2:42875338-42875360 CCTGGTTAGGGGTAGATCAGGGG + Intergenic
929571639 2:43026692-43026714 CCTGGCCACGGGCTGCTGGGAGG - Intergenic
932606166 2:73167064-73167086 CATGTGCTCGGGCAGCTCAGAGG + Intergenic
933665276 2:84959856-84959878 CCTGCCCAAGGGCAGCCCAGTGG + Intergenic
933926262 2:87093387-87093409 CATGTGCTCGGGCAGCTCAGAGG - Intergenic
935297821 2:101665854-101665876 CCTGGAATCGGGCAGCTCAGTGG + Intergenic
938177016 2:129143081-129143103 CCTGCTCCCAGGCAGCTCATGGG - Intergenic
940005160 2:149003393-149003415 CCTGGCCCCGGGCAGCTGACTGG + Intronic
946165671 2:217862419-217862441 CCTGCTCAGGGCCACCTCAGGGG - Intronic
948806322 2:240454838-240454860 ACTGGTCACGGGCAGCTGCCAGG + Intronic
948836895 2:240630267-240630289 CCTGGTCACGGCCATCGCCGTGG + Exonic
1169675241 20:8145467-8145489 CCTGGTAAAGCGTAGCTCAGAGG + Intronic
1170351474 20:15446652-15446674 AGTGATCACCGGCAGCTCAGGGG + Intronic
1171020905 20:21583227-21583249 CAGGGTGATGGGCAGCTCAGTGG + Intergenic
1174034438 20:47659568-47659590 CCTGGTCTCGGGCAGACCAGAGG + Intronic
1175894332 20:62329390-62329412 CCTGGGCCCTGGCTGCTCAGGGG + Intronic
1179097048 21:38325304-38325326 TCTGGACACTGGCGGCTCAGGGG - Intergenic
1179638623 21:42731946-42731968 CCAGGTAACGGGCAGCTCCTCGG + Exonic
1180294684 22:10873619-10873641 TCTGCCCCCGGGCAGCTCAGGGG + Intergenic
1180497490 22:15903033-15903055 TCTGCCCCCGGGCAGCTCAGGGG + Intergenic
1181038302 22:20180251-20180273 CCTGCTCACGGGCGGCTAAAAGG + Intergenic
1183197107 22:36361115-36361137 CCTGGGCACTGGCAGCTGGGAGG - Intronic
1183589708 22:38772863-38772885 GCTGTTCAAGGGCAGCACAGCGG - Intronic
1184758528 22:46531733-46531755 CCTGGTAACCGGGAGCTGAGTGG - Intronic
1184934183 22:47706976-47706998 CTTGGAGTCGGGCAGCTCAGTGG + Intergenic
950132217 3:10555011-10555033 CTTGGGCACAGGCAGGTCAGAGG + Intronic
950639481 3:14339610-14339632 CCTGGTGATGGGCAGCAGAGGGG + Intergenic
957991053 3:87627840-87627862 CCTGGAATTGGGCAGCTCAGCGG - Intergenic
961403256 3:126662016-126662038 CCTGGACAAGGGGAGCTCTGAGG + Intergenic
967048317 3:185757898-185757920 TGTTGTCACGGGCAGGTCAGAGG - Intronic
968503971 4:963556-963578 TCTGTTCACACGCAGCTCAGTGG - Intronic
968554315 4:1239542-1239564 CCTGGATACTGGCAGCTCGGTGG - Intronic
968554642 4:1240744-1240766 GGTGGTCAGGGGCAGCTCATGGG - Intronic
968627006 4:1630264-1630286 CCTGGTCACGGGCAGCTCAGAGG - Intronic
968655893 4:1778323-1778345 CCTGGCCACGGCCATCTCCGGGG - Intergenic
969428528 4:7139639-7139661 CTTGGCTACAGGCAGCTCAGTGG - Intergenic
969586704 4:8098031-8098053 GCTGGTCACCACCAGCTCAGAGG + Intronic
971920673 4:32935060-32935082 CCTGGTCAGGGACAGCCCAGGGG - Intergenic
972135693 4:35890574-35890596 CCTGGTGACTTGCAACTCAGTGG + Intergenic
986287842 5:6373174-6373196 CCTAGTCACAGGCAGGTCACAGG - Intronic
987212126 5:15693796-15693818 CCTGGAGTCGGGCTGCTCAGCGG - Intronic
992307280 5:75454933-75454955 ACTGGTGACGACCAGCTCAGTGG + Intronic
995544068 5:113212754-113212776 CCTGCCCACAGGGAGCTCAGAGG + Intronic
998176155 5:139903542-139903564 ACTGGTCTCGGGCTTCTCAGAGG - Intronic
1003364572 6:5460292-5460314 CCTAGGCAGGGGCAGGTCAGAGG - Intronic
1004528673 6:16433532-16433554 CTTTGTCACGTGCAGCCCAGAGG + Intronic
1005589545 6:27310304-27310326 CCTGGTCAAGGCCACCTCTGTGG - Exonic
1007854894 6:44845754-44845776 CCTGGTGTCGGGTTGCTCAGTGG - Intronic
1012731469 6:102887743-102887765 CCTGGAGTTGGGCAGCTCAGTGG + Intergenic
1016079634 6:139840000-139840022 CCTCGTGATGGACAGCTCAGAGG - Intergenic
1020058755 7:5136580-5136602 CCTGGTCCCGAGAACCTCAGAGG - Intergenic
1022226550 7:28369430-28369452 GCTGGACACTGACAGCTCAGGGG - Intronic
1026111078 7:67459344-67459366 CCTGGAGTTGGGCAGCTCAGTGG + Intergenic
1026250571 7:68666458-68666480 CTTGGTCTCTGGCAGCGCAGAGG - Intergenic
1028178965 7:87693985-87694007 CATGCTCCCGTGCAGCTCAGTGG - Intronic
1034434274 7:151055690-151055712 CCAGGGCACGGGGAGCACAGAGG - Intronic
1034467007 7:151235714-151235736 CCTGGCCACTGGCCGCTCTGTGG + Intronic
1034818058 7:154191251-154191273 CATGGTCACGGGCATCTTAATGG + Intronic
1035584192 8:759401-759423 CCTGGAAACGTGCAGCCCAGGGG - Intergenic
1036667705 8:10758432-10758454 CCTGGCCACTGGGATCTCAGCGG - Intronic
1038192959 8:25340626-25340648 CATCGGCACGGGCAGTTCAGTGG + Intronic
1041455713 8:58057146-58057168 CCTGGTCATGGGCTGCCTAGAGG + Intronic
1043168013 8:76928462-76928484 CCCGGTCAAGAGCAGTTCAGTGG - Intergenic
1046123607 8:109876687-109876709 CCTGGTGAAGGGGAGCTCTGTGG + Intergenic
1046439204 8:114236586-114236608 CCTGGTGTCGGGCCACTCAGGGG - Intergenic
1047282667 8:123459526-123459548 CCTGGACAGGGGCTGCTCACTGG - Intronic
1048339242 8:133526007-133526029 CCTGGTCCCTGCCAGCTCTGTGG + Intronic
1048386053 8:133913520-133913542 GGTGGTCAAGGGCAGCTGAGAGG - Intergenic
1049209448 8:141378791-141378813 CCTGGGCAGGGGCAGGGCAGGGG + Intergenic
1049416536 8:142498024-142498046 CCTGGGTAAGGGCAGCTGAGAGG - Intronic
1050020306 9:1276832-1276854 CTTGGACAAGGGCATCTCAGGGG + Intergenic
1051144060 9:14007751-14007773 CCTGGAATCGGGCTGCTCAGTGG - Intergenic
1052715860 9:32116537-32116559 GCTGGGCACTGGCAGTTCAGCGG + Intergenic
1053032881 9:34797498-34797520 CCCGGAGTCGGGCAGCTCAGTGG + Intergenic
1055734451 9:79312499-79312521 CCTGGAGTCGGGCCGCTCAGAGG - Intergenic
1056331607 9:85525779-85525801 CCTGGGCAAAGGGAGCTCAGAGG - Intergenic
1056688144 9:88783725-88783747 CCTGGTCACTGGCAGCTCACTGG - Intergenic
1058613306 9:106798594-106798616 CCTGAGGACGGGCAGCTAAGCGG + Intergenic
1060182118 9:121541542-121541564 ACTGCTCACTGGCAGCTGAGAGG - Intergenic
1060435563 9:123589853-123589875 AGTGGTCAGGGGCAGCTGAGAGG + Intronic
1060831895 9:126722571-126722593 CCTGCTCCCGGGGAGCGCAGCGG - Intergenic
1060918553 9:127405179-127405201 CCTGCTCGAGGGCTGCTCAGGGG - Intronic
1061706892 9:132460204-132460226 CCAGTTCCCGGGCAGTTCAGCGG + Intronic
1062039963 9:134400019-134400041 CCTGGCCAAGGCCAGCTCAGAGG - Intronic
1062543280 9:137050934-137050956 CCTGGTCACGGCCATAGCAGAGG + Exonic
1062623174 9:137431645-137431667 CCTGGTCACTCGCACCCCAGTGG - Intronic
1187526881 X:20062260-20062282 CCTGGCCACCAGCTGCTCAGTGG + Intronic
1188055243 X:25533323-25533345 ACTGGTGATGAGCAGCTCAGTGG + Intergenic
1190844915 X:54182848-54182870 CCGGGCCCCGGGCAGCTGAGGGG + Exonic
1192215601 X:69156184-69156206 CCAGGGCAAGAGCAGCTCAGGGG - Intergenic
1192784159 X:74321491-74321513 CCTGGAGTCGGGCCGCTCAGTGG - Intergenic
1195114989 X:101688266-101688288 CCTGGTGACAGGGTGCTCAGAGG + Intergenic
1198881233 X:141283495-141283517 CCTTGGCAAGAGCAGCTCAGTGG + Intergenic
1200036352 X:153334181-153334203 GCTGGGCACGGGCGGCTCCGTGG + Exonic
1201922900 Y:19253820-19253842 CCTGGTCATGGGCAGTTTAGAGG + Intergenic