ID: 968627914

View in Genome Browser
Species Human (GRCh38)
Location 4:1636374-1636396
Sequence GAGACCTCTGCCTAGGACGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968627908_968627914 -7 Left 968627908 4:1636358-1636380 CCACCAAGAGGATTACGAGACCT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 968627914 4:1636374-1636396 GAGACCTCTGCCTAGGACGGGGG 0: 1
1: 0
2: 1
3: 7
4: 113
968627905_968627914 19 Left 968627905 4:1636332-1636354 CCTTTTGAGTCTACTTGACCGAT 0: 1
1: 0
2: 0
3: 0
4: 40
Right 968627914 4:1636374-1636396 GAGACCTCTGCCTAGGACGGGGG 0: 1
1: 0
2: 1
3: 7
4: 113
968627909_968627914 -10 Left 968627909 4:1636361-1636383 CCAAGAGGATTACGAGACCTCTG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 968627914 4:1636374-1636396 GAGACCTCTGCCTAGGACGGGGG 0: 1
1: 0
2: 1
3: 7
4: 113
968627904_968627914 30 Left 968627904 4:1636321-1636343 CCTTATTGTTTCCTTTTGAGTCT 0: 1
1: 0
2: 2
3: 40
4: 496
Right 968627914 4:1636374-1636396 GAGACCTCTGCCTAGGACGGGGG 0: 1
1: 0
2: 1
3: 7
4: 113
968627907_968627914 1 Left 968627907 4:1636350-1636372 CCGATTAACCACCAAGAGGATTA 0: 1
1: 0
2: 0
3: 15
4: 226
Right 968627914 4:1636374-1636396 GAGACCTCTGCCTAGGACGGGGG 0: 1
1: 0
2: 1
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968627914 Original CRISPR GAGACCTCTGCCTAGGACGG GGG Intronic
900004224 1:34105-34127 GAGACCTCTGCCTGAGAACGTGG + Intergenic
900023952 1:204621-204643 GAGACCTCTGCCTGAGAACGTGG + Intergenic
902863659 1:19263152-19263174 AAAACCTCCGCTTAGGACGGTGG + Intergenic
905656725 1:39690654-39690676 GGGGCCTCTGCCTAGCACTGGGG + Intronic
906686759 1:47767914-47767936 GAGGCGTCTGGCCAGGACGGTGG - Intronic
907318320 1:53586866-53586888 GAGTCCCCTCCCTAGGACAGAGG - Intronic
912454080 1:109786247-109786269 GTGGCCGCTGCCTATGACGGTGG + Intergenic
917156203 1:172001685-172001707 GAGACCTCTGGCTGGGAAAGAGG + Intronic
917981420 1:180271955-180271977 GAGAGCTCTGCAGAGGACTGTGG + Exonic
1063375607 10:5552525-5552547 GAGACCTCTGTCCAGGGCGATGG + Intergenic
1063397684 10:5706713-5706735 GAAACCTAGGCCTAGCACGGTGG + Intronic
1069885103 10:71618641-71618663 GAGGGCTCTCCCGAGGACGGTGG - Intronic
1070407801 10:76112357-76112379 GAGATCTGTGGCCAGGACGGCGG + Intronic
1074930158 10:118116909-118116931 GGGACCTCTGCCGAGCACAGTGG + Intergenic
1074987302 10:118669606-118669628 GGGACCGCAGCCTTGGACGGAGG + Intergenic
1077469467 11:2750265-2750287 GAGCCCTCAGCCCAGGGCGGAGG + Intronic
1079005364 11:16788128-16788150 CAGACCTCTGCCAATGACTGTGG + Exonic
1079250485 11:18783450-18783472 GAGACACCTGCCCAGGACGGAGG - Intronic
1081575753 11:44317721-44317743 GACAGCTCTGCCCAGGACAGTGG - Intergenic
1083596166 11:63919121-63919143 GAGGCTTCTGCCTAGGAGGTGGG + Intergenic
1085130463 11:74033721-74033743 GAGAACCCTGCCTAGGCAGGTGG + Exonic
1085534919 11:77211996-77212018 GAGACTCCTCCCTAGGACTGTGG + Intronic
1089840477 11:121413219-121413241 GAGAACACTGACTAGTACGGTGG - Intergenic
1091377648 12:36153-36175 GAGACCTCTGCCTGAGAACGTGG + Intergenic
1095743520 12:45632736-45632758 GAGAGCCCTGCCAAGAACGGAGG + Intergenic
1100581279 12:95942793-95942815 GAAACCTCTGCCTAGGGTGCTGG - Exonic
1101128205 12:101661226-101661248 GAGCCTCCTGCCTACGACGGAGG + Exonic
1102566040 12:113798128-113798150 GAGACCCCGGCCCAGGAAGGAGG - Intergenic
1104444981 12:128825235-128825257 GAGACCCCGGCCTGGGATGGTGG + Intergenic
1107097556 13:36552806-36552828 GAGACATTTACCTAGGACAGTGG + Intergenic
1107434245 13:40367777-40367799 AAGACTTCTGCCTAGGACTTTGG - Intergenic
1110598316 13:77342638-77342660 GAGACGTCTTCCTGGGACTGTGG - Intergenic
1115819782 14:37201653-37201675 GACACCTCTTCCCAGGATGGAGG + Intronic
1116502541 14:45637982-45638004 GAGACCTCAGTATAGGACTGGGG + Intergenic
1118613933 14:67562523-67562545 AAGACCTCTGCCAGGGAAGGTGG + Exonic
1122418014 14:101559672-101559694 GAGACGCCTGCCTTGGGCGGAGG - Intergenic
1125329264 15:38565728-38565750 GAGACCTCTGACTTGGACTGAGG + Intergenic
1127974643 15:63988131-63988153 GAGTCCTCTGCCTGGGAAGAGGG - Intronic
1132375052 15:101323344-101323366 CAGACCTTTGCAAAGGACGGAGG - Intronic
1132449280 15:101956839-101956861 GAGACCTCTGCCTGAGAACGTGG - Intergenic
1136412507 16:30085542-30085564 GAGCCCTCTCCCTAGGGCTGGGG - Intergenic
1138591648 16:58002488-58002510 GAAATCTCTGCCTGGGAAGGGGG - Exonic
1139464121 16:67145063-67145085 GAGGCCTCTTCCTATGACTGTGG + Intronic
1143149971 17:4801687-4801709 GAGACCTATGCCAAGCATGGTGG - Intergenic
1143898748 17:10157208-10157230 GAGTCCTCAGCCTAGGAAAGGGG + Intronic
1144759915 17:17701312-17701334 GAGCCTTCTGCCTAGGCAGGGGG + Intronic
1145065392 17:19758208-19758230 GAGACCTCTCCCAAGGATGAGGG - Intergenic
1147948922 17:44096168-44096190 GATACCACTGCCTGGGAAGGCGG + Intronic
1147979537 17:44266101-44266123 GAGACCCCTGCCTTGGCAGGTGG + Intronic
1148790203 17:50168511-50168533 GTCACCTCTGCCTTGGACCGTGG + Exonic
1152630205 17:81407550-81407572 GAGACCTGAGCCCAGGATGGGGG + Intronic
1155064210 18:22254755-22254777 GAGGCCTCTGCCAGGGACGGGGG - Intergenic
1158335809 18:56414263-56414285 GAAACCTCTGCCTAGTTCAGAGG + Intergenic
1160592194 18:79951158-79951180 GCGGCCCCTGCCTGGGACGGGGG + Intronic
1160635976 19:75714-75736 GAGACCTCTGCCTGAGAACGTGG + Intergenic
1161064702 19:2231901-2231923 GAGACTTCTGCCTGGGCCAGTGG - Exonic
1163440747 19:17321547-17321569 GAGACCTCTGCCAGGCACGGTGG - Exonic
1165235820 19:34420832-34420854 GGGACCTCTGCCTTAGAGGGAGG - Intronic
1167724280 19:51200168-51200190 GAGAGCTCTGCCTGGGGAGGGGG - Intergenic
925592627 2:5525665-5525687 GAGAACTCTGAATAGGAGGGAGG - Intergenic
926119685 2:10235239-10235261 GATACCTCCTCCTAGGGCGGGGG + Intergenic
930095115 2:47560908-47560930 GAGGCTTCTGCCTGGGAAGGGGG + Intronic
930689649 2:54347700-54347722 CAAACCTCTGCCTAGGATGGAGG + Intronic
935107180 2:100055403-100055425 GAGACCACTGGCCAGGAGGGAGG - Intronic
936565504 2:113579338-113579360 GAGACCTCTGCCTGAGAACGTGG - Intergenic
936923055 2:117708798-117708820 GAGACCTCTTCCTAAGACAAGGG - Intergenic
938708954 2:133958754-133958776 GGGACCTCTCTCTAGGAAGGAGG - Intergenic
945923731 2:215782574-215782596 GTGACCTCTAACTAGGACAGTGG - Intergenic
947947534 2:234119513-234119535 TAGACCCCTGGCTAGGAAGGTGG + Intergenic
948205875 2:236162642-236162664 CCGACCTCTGCCTGGGTCGGTGG + Intergenic
1168880004 20:1198324-1198346 GGGACCTCTGCCTACGAGGTTGG - Intergenic
1175173699 20:57096793-57096815 GAAACCTCTGCACAGGAGGGAGG + Intergenic
1181747390 22:24965121-24965143 GAGACCTCGGCTGGGGACGGTGG + Intronic
1183735392 22:39642206-39642228 GAACCCTCTGCCCAGGAGGGTGG + Intronic
950006499 3:9694922-9694944 CAGACCTCTGCCTAGGAGGGTGG - Intronic
958675692 3:97265644-97265666 GGGTCCTCTGCCTGGGAGGGTGG + Intronic
961718546 3:128876045-128876067 GAGGCCTCTGCCTAGAGCTGGGG - Intergenic
965080148 3:164023396-164023418 AAGTCCTCGGCCTAGAACGGGGG + Intergenic
967303481 3:188039046-188039068 GGGATCTGTGCCTAGGATGGAGG + Intergenic
968627914 4:1636374-1636396 GAGACCTCTGCCTAGGACGGGGG + Intronic
971504225 4:27348525-27348547 GAGAGCTCTTCCTAGGAGGTAGG + Intergenic
976692881 4:87887384-87887406 GAGACTTCTGCTTAGGGTGGAGG - Intergenic
978757142 4:112314765-112314787 GAGACCTCGACCTAGGATGGTGG + Intronic
980255168 4:130371124-130371146 GAGACTTCTGCCTGGCATGGTGG + Intergenic
985661013 5:1156421-1156443 GAGGCCTCTGCCTCGCACGCAGG - Intergenic
985705804 5:1400726-1400748 GAGACGTGTGCCCGGGACGGGGG - Intronic
985895786 5:2749381-2749403 GAGACCTCGGCAGAGGACGAAGG - Exonic
990728999 5:58787772-58787794 GAGCTCTGTGCCTAGGTCGGCGG + Intronic
991963889 5:72072381-72072403 GAGACCTCACCCTAGGTCTGTGG + Intergenic
992104783 5:73440927-73440949 GAGACCTCTGGCAAGGCAGGTGG + Intergenic
992150776 5:73900672-73900694 GAGACATCTTTCTAGGAAGGCGG - Intronic
994018396 5:94995151-94995173 GAGAACGCTGACTAAGACGGGGG + Intronic
995534229 5:113119391-113119413 GAGACAGCTGCCGAGGAAGGAGG + Intronic
997995720 5:138584432-138584454 GAGAGCTCTGCAGAGGAGGGAGG + Intergenic
998142926 5:139709977-139709999 GCGGCCTCAGCCTAGGAGGGCGG + Intergenic
1002846553 6:950946-950968 GAGAGCACAGCCTAGGATGGTGG - Intergenic
1003982796 6:11405164-11405186 GAGCCCTCTGCTCAGGAAGGGGG - Intergenic
1006900869 6:37500055-37500077 GAGACCTCAGCCTAGATGGGTGG + Intergenic
1010554148 6:77258275-77258297 AAGACCTCTGCCCAGAACTGAGG - Intergenic
1010839719 6:80634989-80635011 GGGACCTCTGCCTTGGAAGCAGG + Intergenic
1012037711 6:94163786-94163808 GAGACCTCAGATTAGGATGGTGG + Intergenic
1013236169 6:108199148-108199170 GGGTCCTGTGCCTAGGAGGGTGG + Intergenic
1016083167 6:139880012-139880034 GAGACCAATGCTTAGGACTGAGG - Intergenic
1022965611 7:35468560-35468582 GAGACCTCTCCCCAGGATGGGGG + Intergenic
1023842204 7:44104141-44104163 GAGACTTGCGCCTAGGACAGAGG - Intergenic
1027779969 7:82508171-82508193 GAGTCCTGTGCCTAAGAGGGCGG + Intergenic
1033013733 7:137650450-137650472 AAGACCTCTGCAAAGGACTGGGG + Intronic
1036773514 8:11594346-11594368 GAGACCTCGGACTAGAAGGGAGG + Intergenic
1039377137 8:37045728-37045750 CAGGCCTCTGCCTAGGAAGCAGG + Intergenic
1045510702 8:102810407-102810429 GAGAGCCCGGCCTGGGACGGCGG - Intergenic
1046064153 8:109176749-109176771 GAGGCCACTGTCTAGGAGGGAGG - Intergenic
1046974769 8:120262048-120262070 TAGACCACTGCCTAGAAGGGTGG + Intronic
1048865593 8:138759175-138759197 CAGACCTCAGCTTAGGATGGGGG - Intronic
1049800567 8:144515739-144515761 GAGACATCTGCCCTGGAGGGTGG - Intronic
1049886921 9:33888-33910 GAGACCTCTGCCTGAGAACGTGG + Intergenic
1053187587 9:36031477-36031499 GAGACCTCAGCCTATGATGCTGG - Intergenic
1057840329 9:98481101-98481123 CAGAGCTCTGCCTGGGAAGGTGG + Intronic
1059566243 9:115385607-115385629 GGGTCCTGTGCCTAGGAGGGTGG - Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061284338 9:129613619-129613641 GAGATCTCTGCCCAGGAGGAGGG + Intronic
1186510293 X:10125401-10125423 GAGACCTCTGGCTGGGACCAGGG + Intronic
1187081755 X:15997197-15997219 GAGTCCTCTGTCTAGCACAGTGG + Intergenic