ID: 968631245

View in Genome Browser
Species Human (GRCh38)
Location 4:1653266-1653288
Sequence CACACCTCACACTCTACCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968631238_968631245 -10 Left 968631238 4:1653253-1653275 CCTTGCCTCTACCCACACCTCAC 0: 1
1: 0
2: 1
3: 73
4: 724
Right 968631245 4:1653266-1653288 CACACCTCACACTCTACCGGGGG No data
968631230_968631245 28 Left 968631230 4:1653215-1653237 CCGGGTGTCCATGAGCCCTGGTC 0: 1
1: 0
2: 0
3: 16
4: 184
Right 968631245 4:1653266-1653288 CACACCTCACACTCTACCGGGGG No data
968631237_968631245 6 Left 968631237 4:1653237-1653259 CCTGGGTCTGGCGAGTCCTTGCC 0: 1
1: 0
2: 2
3: 8
4: 214
Right 968631245 4:1653266-1653288 CACACCTCACACTCTACCGGGGG No data
968631229_968631245 29 Left 968631229 4:1653214-1653236 CCCGGGTGTCCATGAGCCCTGGT 0: 1
1: 0
2: 2
3: 22
4: 202
Right 968631245 4:1653266-1653288 CACACCTCACACTCTACCGGGGG No data
968631235_968631245 13 Left 968631235 4:1653230-1653252 CCCTGGTCCTGGGTCTGGCGAGT 0: 1
1: 0
2: 1
3: 5
4: 124
Right 968631245 4:1653266-1653288 CACACCTCACACTCTACCGGGGG No data
968631236_968631245 12 Left 968631236 4:1653231-1653253 CCTGGTCCTGGGTCTGGCGAGTC 0: 1
1: 0
2: 1
3: 10
4: 134
Right 968631245 4:1653266-1653288 CACACCTCACACTCTACCGGGGG No data
968631233_968631245 20 Left 968631233 4:1653223-1653245 CCATGAGCCCTGGTCCTGGGTCT 0: 1
1: 0
2: 0
3: 33
4: 368
Right 968631245 4:1653266-1653288 CACACCTCACACTCTACCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968631245 Original CRISPR CACACCTCACACTCTACCGG GGG Intronic
No off target data available for this crispr