ID: 968631765

View in Genome Browser
Species Human (GRCh38)
Location 4:1655567-1655589
Sequence CCGCGCCCAGGCGCAGGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968631765_968631778 26 Left 968631765 4:1655567-1655589 CCCAGGCCTGCGCCTGGGCGCGG 0: 1
1: 0
2: 1
3: 28
4: 247
Right 968631778 4:1655616-1655638 TGGTGTGAGCGGCAGCAGACAGG 0: 1
1: 0
2: 0
3: 8
4: 143
968631765_968631773 6 Left 968631765 4:1655567-1655589 CCCAGGCCTGCGCCTGGGCGCGG 0: 1
1: 0
2: 1
3: 28
4: 247
Right 968631773 4:1655596-1655618 TGGCTGCCACTGAAGACCCATGG 0: 1
1: 0
2: 0
3: 22
4: 206
968631765_968631775 15 Left 968631765 4:1655567-1655589 CCCAGGCCTGCGCCTGGGCGCGG 0: 1
1: 0
2: 1
3: 28
4: 247
Right 968631775 4:1655605-1655627 CTGAAGACCCATGGTGTGAGCGG 0: 1
1: 0
2: 2
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968631765 Original CRISPR CCGCGCCCAGGCGCAGGCCT GGG (reversed) Exonic
900089479 1:913591-913613 CCTTGGCCAGGCCCAGGCCTTGG - Intergenic
900462985 1:2810233-2810255 CCGCAGCCAGTCTCAGGCCTGGG - Intergenic
900494303 1:2969526-2969548 CCAGGCCCAGGCCCAGGCCCAGG - Intergenic
901766306 1:11502162-11502184 CCAGGCCCAGGCCCAGGCCCAGG + Intronic
901783196 1:11608189-11608211 CCACCCACAGGCTCAGGCCTGGG - Intergenic
903153335 1:21428412-21428434 GCGCGCCCAGGCTCAGTCCTGGG - Intergenic
903378719 1:22882532-22882554 CCTCTCCCAGGCTGAGGCCTGGG + Intronic
903706193 1:25287504-25287526 CCGTCCCCAGGGGCAGGCCTGGG - Intronic
903721047 1:25405870-25405892 CCGTCCCCAGGGGCAGGCCTGGG + Intronic
905580805 1:39081731-39081753 CCGCTCCCCGGCGCCGGCCGCGG - Intronic
905862827 1:41362125-41362147 CCGCGCCCAGGGGCGGCGCTGGG - Exonic
906695012 1:47817836-47817858 GTGGGCCCAGGAGCAGGCCTGGG + Intronic
907243519 1:53093341-53093363 CTGTGCCCAGGCTCAGCCCTGGG - Intronic
908555591 1:65254320-65254342 CCGCGCGCACCCGCACGCCTCGG + Intronic
910841419 1:91565578-91565600 CTGTGCCCAGGCGCAGGCCCTGG - Intergenic
915561529 1:156690993-156691015 CCAAGGCCAGGCACAGGCCTGGG + Intergenic
915581061 1:156813766-156813788 CAGAGCCCAGGCGCAGGACGCGG - Intronic
919821652 1:201476763-201476785 CCAGGCCCAGGAGCAAGCCTGGG - Intergenic
1063458515 10:6201595-6201617 CCGCGCCCAGGCGGCGACCGGGG - Intronic
1064209086 10:13348137-13348159 CGGCGCCCAGGCGCGGGCCCGGG - Exonic
1064461046 10:15535164-15535186 CCTCCCCCAGGGGCAGGGCTCGG + Intronic
1065025352 10:21535031-21535053 CCGGCCCCAGGCGCAGGCGGCGG - Intronic
1065100460 10:22325836-22325858 CCGCGCTCAGGCCCCGGCCCAGG + Intronic
1067157303 10:43792837-43792859 TGGGGCCCAGGCCCAGGCCTAGG + Intergenic
1067941323 10:50659475-50659497 CCGCGTCCAGCCCCAGGCCCTGG - Intergenic
1068620623 10:59177145-59177167 CCGCGCCAAGGCGCGAGCCCCGG - Intronic
1069413148 10:68173686-68173708 CCGCCTCCAGGCTCAAGCCTGGG + Intronic
1069752614 10:70753916-70753938 CCGGTCCCCGGCGCAGGCTTTGG - Exonic
1069831466 10:71284715-71284737 CCTCGCGCACCCGCAGGCCTGGG - Exonic
1070566132 10:77605141-77605163 CCGCGCCCAGCCGCAGCCCAGGG + Intronic
1072692652 10:97582182-97582204 CCCCTCCAAGGCTCAGGCCTTGG + Intronic
1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG + Exonic
1073491182 10:103854712-103854734 CTGCCCCCAGCCCCAGGCCTAGG + Intronic
1073577840 10:104640577-104640599 CCGCGCGGGGGCGCAGGCCTTGG + Intergenic
1074111208 10:110423850-110423872 CAGCGGCCAGGGGCAGGCCCTGG + Intergenic
1075101864 10:119511791-119511813 CCACGCCCAGGCTCAGGCCTCGG + Intronic
1076614030 10:131744566-131744588 CCAAGCTCAGGCGGAGGCCTGGG + Intergenic
1076696220 10:132248643-132248665 CCACGCCCACGTGCATGCCTAGG + Intronic
1076754603 10:132562757-132562779 CCACGCCCAGGACCAGACCTTGG + Intronic
1076792761 10:132785738-132785760 CCGCGCCCACGGGCCGGCCCAGG + Exonic
1076852555 10:133100165-133100187 CCAGGCCCAGGCCCAGGCCGGGG - Intronic
1076852560 10:133100171-133100193 CTGGGCCCAGGCCCAGGCCCAGG - Intronic
1076908279 10:133373784-133373806 GCGCGCCCAGGCGCAGGGCCAGG + Intergenic
1078801079 11:14644342-14644364 CCGCGCCCAGCAGCAGGGCGAGG - Exonic
1079368207 11:19827871-19827893 GCGAGCCCACGCCCAGGCCTAGG + Intronic
1080230312 11:30012589-30012611 CCGCTCCCGGGCCCGGGCCTGGG + Exonic
1080827794 11:35862373-35862395 CCAAGCCCAGGCCCAGGCCCAGG + Intergenic
1081706068 11:45182460-45182482 CCAGGCCCAGGTCCAGGCCTTGG + Intronic
1081807955 11:45900359-45900381 CCGGGCCCTGGCTCTGGCCTTGG - Exonic
1082756103 11:57078177-57078199 CCACGCCCAGTCGCTGGCTTCGG + Intergenic
1083941977 11:65900661-65900683 CCGCGCCCAGGTGGAGCCCCGGG + Intergenic
1084203682 11:67578453-67578475 CTGAGCCCAGGCGCAGGGATGGG - Intergenic
1084562294 11:69911747-69911769 CCGCGCCCAGCCCCAGGTCCGGG - Intergenic
1084646858 11:70463906-70463928 CCGGGCCCAGGCGCGTTCCTTGG - Intergenic
1085413840 11:76307374-76307396 CCTGGGCCAGGCCCAGGCCTTGG - Intergenic
1085519529 11:77129973-77129995 CCGGGCCCGGGCCCAGGCCCAGG + Intronic
1088758512 11:112907306-112907328 CCGAGCCCAGGCCCAGGCGAGGG + Intergenic
1092216776 12:6689122-6689144 CCGCGCCCTGGCTCAGGCTCTGG - Intronic
1096139927 12:49234520-49234542 CCGAGCCCAGGCCCAGGCCCTGG - Intronic
1096316531 12:50571846-50571868 CCGCGCCCAGCCTGAGACCTAGG + Intronic
1096473035 12:51890759-51890781 CCAGGCCCAGGCCCAGGCCCAGG + Exonic
1097250020 12:57627459-57627481 TCTCGCCCAGGTGCAGGTCTTGG + Intronic
1101965942 12:109281845-109281867 CCGGGCCCCAGCCCAGGCCTGGG + Intronic
1102128079 12:110501912-110501934 CAGGGCCCAGGCGCTGGCCTGGG - Intronic
1102229168 12:111250424-111250446 ACGCTCCCAGGGGCAGCCCTGGG - Intronic
1102520084 12:113472486-113472508 CCGAGCCCAGGCCCAGGCCCAGG + Intergenic
1103896958 12:124279410-124279432 TCGGGCCCAGGAGCAGGGCTGGG + Intronic
1104035886 12:125096884-125096906 CAGTGCCCAGGCGCTGGTCTAGG + Intronic
1104376566 12:128268512-128268534 CCGCGCCCTGGCGAAGGTCTCGG + Intronic
1104735019 12:131131258-131131280 GCTCGCACAGCCGCAGGCCTGGG + Intronic
1104926668 12:132317397-132317419 GTGTGCCCAGGCCCAGGCCTTGG + Intronic
1105557247 13:21459018-21459040 CCGCGCCCCGCCGCAGTCCCCGG + Intronic
1108363834 13:49691322-49691344 CGCGGCCCAGGCGCAGGCCCAGG + Exonic
1112428062 13:99323043-99323065 CCTCGCCCAGAAGCAGGCCAGGG - Intronic
1112508360 13:99988915-99988937 CCACCCCCAGGCCCAGGCCCAGG - Intergenic
1113636899 13:111925637-111925659 CTGTGCCCAGGAGGAGGCCTGGG + Intergenic
1114066396 14:19062564-19062586 CCGCCCCCACGCGGAGGACTCGG - Intergenic
1114095872 14:19337460-19337482 CCGCCCCCACGCGGAGGACTCGG + Intergenic
1114268528 14:21087414-21087436 CCGCGTCGAGGAGGAGGCCTGGG + Exonic
1114736797 14:25050277-25050299 CCGCGACCCGCCCCAGGCCTCGG + Exonic
1119672750 14:76531889-76531911 CCTCGCCCAGCAGCAGGCCCGGG + Intergenic
1119778024 14:77260239-77260261 CCACGCCCAGGCCCACACCTTGG - Intergenic
1120941502 14:89954628-89954650 CCGCGACCTGGCTCTGGCCTCGG + Exonic
1121009567 14:90512152-90512174 CCTCCCCCAGGCCCAGCCCTGGG - Intergenic
1121456771 14:94043395-94043417 CCAGGGCCAGGCCCAGGCCTGGG + Intronic
1122541432 14:102499759-102499781 CCTGGCCCAGGCCCAGTCCTTGG + Exonic
1122626660 14:103088473-103088495 CCACTCTCAGCCGCAGGCCTGGG + Intergenic
1123787457 15:23687389-23687411 CCGCCCCCAGCCGCTGGCCAAGG - Intergenic
1126010063 15:44294285-44294307 CCGTGCCCAGCTGCAGACCTTGG - Intronic
1126849247 15:52787581-52787603 CTTCGCCAAGGCTCAGGCCTGGG + Intronic
1128504459 15:68256875-68256897 CCGCGCCCAGGACCTTGCCTGGG - Intronic
1129612287 15:77070690-77070712 CCGCGCCCAGGCTCCCGGCTTGG + Intronic
1129902783 15:79164539-79164561 CTGCTCCCAGGCCCAGGCCTGGG + Intergenic
1130557817 15:84935272-84935294 CAGAGCCCAGGCCCAGCCCTCGG + Intronic
1131097069 15:89662971-89662993 CCGTGCTCAGGCCCAGGGCTGGG + Intergenic
1131272387 15:90955177-90955199 CAGGGCCCCGGCGTAGGCCTCGG + Intronic
1132892113 16:2209604-2209626 CCCCGCCCAGGCGGGGGCTTTGG - Exonic
1132991754 16:2799010-2799032 CCGCGCGCGGGCGCTGGCCATGG + Intergenic
1133103613 16:3493697-3493719 CAGCGCCCAGGCCTGGGCCTCGG - Exonic
1133129949 16:3670869-3670891 CCGCGGGCAGGAGCAGGTCTGGG - Intronic
1137477152 16:48818620-48818642 CTCCCCCCAGGCGCAGGCCCAGG - Intergenic
1138647563 16:58436104-58436126 CAGAGCCCAGGCCCAGGCCGGGG - Intergenic
1139140913 16:64261210-64261232 CGCGGCCCAGGCGCAGGCCCAGG + Intergenic
1139593892 16:67947386-67947408 CAGCGCTCAGGGACAGGCCTCGG + Exonic
1140078516 16:71723558-71723580 CCGCGCCCGCGTCCAGGCCTCGG - Intronic
1141620884 16:85235977-85235999 CCAGGCCCAGGCCCAGGCCCAGG - Intergenic
1141650507 16:85390404-85390426 CCCCGGCCAGGCACAGCCCTGGG - Intergenic
1142261022 16:89042505-89042527 CCGCGCCCATCCACACGCCTGGG - Intergenic
1142290448 16:89191773-89191795 TGGCGCCCAGGAGGAGGCCTGGG - Exonic
1143004917 17:3824080-3824102 CCCCGCCCAGCCCCAGGTCTAGG - Intronic
1145275503 17:21426983-21427005 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1145313355 17:21712877-21712899 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1145711802 17:26984833-26984855 CAGAGCCCAGTCCCAGGCCTGGG + Intergenic
1147215903 17:38898887-38898909 CAGCACCCAGGCGCAGACCAGGG - Intronic
1147440347 17:40443707-40443729 CCGCGCCCGCGCCCAGTCCTCGG + Exonic
1148180609 17:45602118-45602140 CCGGGCCCTGGCTCTGGCCTTGG + Intergenic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1148268293 17:46243797-46243819 CCGGGCCCTGGCTCTGGCCTTGG - Intergenic
1148664244 17:49362374-49362396 CGGCGCGCATGCGCAGCCCTCGG + Intronic
1150227947 17:63533882-63533904 CCGCGCCCAGGGACAGGACCTGG - Exonic
1151772928 17:76177025-76177047 CCTGGCCCAGGCCCAGGCCCAGG + Intronic
1151784555 17:76269077-76269099 CCTCCCCCAGGCGCAGGAGTTGG - Intronic
1152065994 17:78112833-78112855 CCACCTCCAGGCGCAGGTCTGGG - Exonic
1152093334 17:78258659-78258681 ACCCGCCCAGGCGCAGGCGCTGG + Intergenic
1154279686 18:12991457-12991479 TCCCGCCTAGGCGCAGGCCGAGG - Intronic
1155300639 18:24426427-24426449 CCCCGCCCCGGCGCATTCCTAGG + Intergenic
1156460679 18:37319802-37319824 CCTGGCCCAGGCCCAGGCCCAGG - Intronic
1157848922 18:51030025-51030047 CCGCGCTGAGGCCCAGGCCCAGG + Intronic
1157987850 18:52459757-52459779 CCGCGCCCAGGCCCAGTATTTGG + Intronic
1160575693 18:79852656-79852678 CCACGCCCAGGTGCAGGCGCTGG - Intergenic
1160872498 19:1283595-1283617 CCTCGCCCAGGGCCAGGCCTCGG + Intergenic
1160902036 19:1433549-1433571 CTGCCCCCACGCCCAGGCCTTGG + Intronic
1160909123 19:1466697-1466719 CCACCCCCAGGCCCCGGCCTCGG - Exonic
1161004844 19:1930018-1930040 CCACGCCCGGACCCAGGCCTGGG + Intergenic
1161327902 19:3672264-3672286 CGGAGACCAGGCGCAGGCCAGGG - Intronic
1162344587 19:10111819-10111841 CCGTGCCCAGCCCCAGACCTAGG - Intronic
1162790758 19:13061494-13061516 CCGCGCCCCGCCGCAGCCCTCGG + Intronic
1163234675 19:16023551-16023573 CCACGGCCAGGGGGAGGCCTGGG - Intergenic
1163313779 19:16529512-16529534 CTGGGCCTAGGAGCAGGCCTGGG + Intronic
1163427126 19:17245833-17245855 TTGGGCCCAGGCGCAGGCCCAGG - Exonic
1164836283 19:31357198-31357220 CCGCGCCAAGGGGCAGCCCCAGG - Intergenic
1165349739 19:35269190-35269212 CCGCGCCCCGGCCCCGGCCCCGG + Intronic
1166543990 19:43623289-43623311 CCCAGCCCAGGCCCAGGCCTAGG + Exonic
1166543995 19:43623295-43623317 CCAGGCCCAGGCCTAGGCCTGGG + Exonic
1167258054 19:48442842-48442864 CTTCGCCCAGGCCGAGGCCTAGG - Exonic
1167738863 19:51312118-51312140 CCGCGCCCCGGGGCAGGGGTCGG + Intronic
925313096 2:2901798-2901820 CCACGTCCAGGAGCAGACCTTGG - Intergenic
926097519 2:10091646-10091668 CCGCGCCGCGGGGCAGGGCTGGG + Intergenic
926107570 2:10162014-10162036 CTGCAGCCAGGCGCAAGCCTCGG - Intronic
926133938 2:10323447-10323469 CCAGGGCCAGGTGCAGGCCTGGG - Intronic
927542618 2:23926694-23926716 CCGGCCCCAGGCCCAGGCCCGGG + Exonic
931249933 2:60521356-60521378 CCAGGCCCAGGCCCAGGCCCGGG - Intronic
932738158 2:74270381-74270403 CCGCGCCCAGCCCCAGGCATTGG - Intronic
934662407 2:96150188-96150210 CCAGGCCCAGGCCCAGGCCCAGG - Intergenic
934662412 2:96150194-96150216 CCACCCCCAGGCCCAGGCCCAGG - Intergenic
934728079 2:96638052-96638074 CCGCTCCCTGGGGCAGGGCTCGG + Intronic
934966983 2:98731489-98731511 GCGCGCCGAGGCGCAGGCCGAGG - Intergenic
934990995 2:98921414-98921436 CAGTGCCCAGAGGCAGGCCTTGG + Intronic
936512198 2:113157457-113157479 CCGCGCCCAGGCGCCGGCTGGGG - Intronic
937081473 2:119143185-119143207 CCCCGCCCTGGCCCAGGCCCCGG - Intergenic
938073047 2:128318431-128318453 GCGCGCCCAGGCTCAGTCCTGGG + Exonic
938133734 2:128737208-128737230 CCGCGCCGAGACCCAGGCCAGGG + Intergenic
938277119 2:130037041-130037063 CCGCGCCCAGCCCGAGGCCAGGG + Intergenic
938438264 2:131300348-131300370 CCGCGCCCAGCCCGAGGCCAGGG - Intronic
938483790 2:131682697-131682719 CCGCCCCCAAGCGGAGGACTCGG - Intergenic
941029251 2:160493218-160493240 ACGCGCGCAGGGTCAGGCCTGGG - Intronic
942448172 2:176092363-176092385 CCGAGACAAGGCGCAGGCCTTGG + Intergenic
945404005 2:209423788-209423810 CCCCGCCCAGCCGCTGGCCCGGG - Intergenic
947732905 2:232440797-232440819 CCCAGCCCAGTTGCAGGCCTGGG - Intergenic
948897789 2:240935268-240935290 CAGTGCCCCGGGGCAGGCCTTGG + Intronic
1170841577 20:19928579-19928601 CCTTGCCCAGGCCCAGCCCTGGG + Intronic
1171217307 20:23361935-23361957 TCCTGCGCAGGCGCAGGCCTTGG + Intergenic
1171484271 20:25476305-25476327 GGGCACCCAGGAGCAGGCCTCGG - Exonic
1173494252 20:43507589-43507611 CCCGGCCCAGGCGCAGGCCCAGG - Intergenic
1175531412 20:59675937-59675959 CCGGGCCCAGGCCCAGGCCCAGG - Intronic
1176009889 20:62887600-62887622 CCGCGTGAAGCCGCAGGCCTCGG - Intronic
1176138187 20:63534163-63534185 GCGCGGCCAGCCGCAGGCCGTGG + Exonic
1176207212 20:63895487-63895509 CCCCGCCCCGGCCCAGGCCGCGG - Intronic
1180095799 21:45554985-45555007 CCGCGCCCAGGAGCACGTCCAGG + Intergenic
1180484874 22:15785155-15785177 CCGCCCCCACGCGGAGGACTCGG - Intergenic
1180908549 22:19432242-19432264 CTGCGCCCTCGCGCGGGCCTCGG - Exonic
1181014606 22:20061895-20061917 CCAGGCCCAGGCCCAGGCCCAGG + Intronic
1181017653 22:20080429-20080451 GCGCGCCCTCGCGCAGGCCGCGG - Intronic
1181855338 22:25777498-25777520 CAGCGCCCCGCCCCAGGCCTAGG - Intronic
1181956189 22:26589642-26589664 ACGCGCCCTGGCGCCCGCCTGGG + Intronic
1183167292 22:36157226-36157248 CTGGGCCCAGATGCAGGCCTGGG - Intronic
1184697487 22:46148139-46148161 CTGCGCCCTGCCGCTGGCCTGGG + Intergenic
950469894 3:13177947-13177969 CCCCACCCAGCCCCAGGCCTAGG - Intergenic
951464829 3:22990452-22990474 CCGCGCCCAGGCGCACTGGTGGG + Intergenic
954132772 3:48568749-48568771 CCAGGCCCAGGCCCAGGCCCAGG - Intronic
954196697 3:49001390-49001412 CAGCGCCCTGGCTCAGTCCTTGG + Intronic
954327943 3:49873742-49873764 CCACACCCAGGCGCAGGCCGAGG - Intergenic
954333587 3:49903645-49903667 CCACGCCCAGGTCCAGGCCCAGG - Intronic
954423861 3:50432945-50432967 CTGTGCCCAGGCTCAGGCCAGGG - Intronic
961346417 3:126266477-126266499 CCGCGGCCAGGAGCAGGACTGGG + Intergenic
961346630 3:126267618-126267640 GCGCGCCCTGGCGCAGTCCCCGG + Intergenic
961364567 3:126391023-126391045 CCACGCCCAGGAGCACACCTGGG + Intergenic
961551455 3:127672586-127672608 CCGCGCCGAGGGCCAGGCCGCGG - Exonic
961554950 3:127691101-127691123 GCAGGCCCAGGCCCAGGCCTAGG + Exonic
965763854 3:172109453-172109475 CCGCGCCCGGCCGAAGGCCTTGG + Intronic
968134914 3:196214276-196214298 CCGCGCCGAGGCAGAGGTCTTGG + Intronic
968141222 3:196258875-196258897 CCGTGCCCAGCCTCTGGCCTGGG + Intronic
968622100 4:1608437-1608459 CCCCGCCCAGGCGCCAGCCACGG + Intergenic
968631765 4:1655567-1655589 CCGCGCCCAGGCGCAGGCCTGGG - Exonic
976700616 4:87965959-87965981 CCGAGCCAAGGCGCTGACCTGGG + Intergenic
986466787 5:8034140-8034162 CCCAGCCCAGGCAAAGGCCTTGG - Intergenic
993727347 5:91383372-91383394 CAGTGCGCAGGCGCAGGCCGCGG + Intergenic
995724675 5:115170237-115170259 CCCCGCCCCGGCGCCGCCCTCGG - Intronic
997215074 5:132103396-132103418 CCTCACCCAGGCTGAGGCCTGGG - Intergenic
997470717 5:134115419-134115441 TCGCGCTCAGGCCCTGGCCTCGG + Intronic
998093369 5:139383477-139383499 CAGCGCCCAGGCGCAGATGTGGG - Intronic
998138697 5:139688103-139688125 CCCCGCCCACCCGCAGCCCTGGG + Intergenic
998317363 5:141194583-141194605 CCCGGCCCAGGCCCAGGCCGAGG + Exonic
998839030 5:146233626-146233648 CCGGGCCCAGGTCCAGGCCCAGG + Exonic
998862617 5:146459078-146459100 CCAGGCCCAGGCCCAGGCCCAGG + Exonic
998862620 5:146459084-146459106 CCAGGCCCAGGCCCAGGCCCAGG + Exonic
1002071322 5:176680355-176680377 CCGCGCCCGGGAGCCGGCCCAGG - Intergenic
1002300182 5:178253357-178253379 CCTCCCCCAGGCCCAGGCCCAGG + Intronic
1002466433 5:179411099-179411121 CAGCCTCCAGGCGCAGGGCTGGG - Intergenic
1002570321 5:180136311-180136333 CCGGGAACAGGCGCAGGCCTGGG + Intronic
1004114193 6:12750086-12750108 GCGCGCCCATGCGCAGGCTGCGG + Intronic
1006406771 6:33850039-33850061 CCGCGCCCAGGGCCAGAGCTGGG + Intergenic
1006606161 6:35259428-35259450 CCGCGCCCAGGCCCTGACCCGGG + Intronic
1010203283 6:73300924-73300946 CCGCGCCCAGCCGAAGGGCAAGG - Intronic
1010776800 6:79896178-79896200 CCGAGCCCAGGCCAAGGCCACGG - Intergenic
1013272893 6:108559728-108559750 CCCCGCCCAGGGGGAGGGCTGGG - Intergenic
1017073716 6:150599797-150599819 CCGCGCCCAGACGCCAGCTTCGG - Intergenic
1018060012 6:160082861-160082883 ACGTGCCCTGGTGCAGGCCTTGG + Intronic
1018653263 6:166008596-166008618 TCGCGCCCAGGAGCCGGACTCGG + Intergenic
1019483354 7:1276309-1276331 CCAGGCCCAGGCCCAGGCCCCGG - Intergenic
1020137384 7:5594585-5594607 CCGCCCCCGGGCCCAGGGCTCGG + Intronic
1022471149 7:30682521-30682543 CCGCCCCCCGGCGCAGCCATTGG - Intronic
1028477502 7:91266845-91266867 CTGCGCCCCGGCCGAGGCCTGGG - Exonic
1029448795 7:100629218-100629240 CCTAGCCCAGGCCCAGGCCCTGG + Intronic
1029610228 7:101622744-101622766 CCAGGCCCAGGCCCAGGCCCAGG + Intronic
1030115923 7:106062265-106062287 CCTTGCCCAGGCTCAGGCCCTGG + Intergenic
1031388753 7:121186979-121187001 CAGAGCCCAGGGGCAGGCCCAGG - Intronic
1031484326 7:122310227-122310249 CCGCGCCGACCCGCTGGCCTTGG + Intronic
1032458397 7:132091639-132091661 CAGAGCCCAGGCACAGGACTGGG + Intergenic
1032709102 7:134447105-134447127 CCGTGTGCAGGGGCAGGCCTTGG - Intronic
1033122700 7:138680018-138680040 CTGGGGCCAGACGCAGGCCTTGG + Intronic
1034188335 7:149195868-149195890 CCGCGCCCAGGCGAGGCCCGAGG + Intronic
1035752003 8:2002722-2002744 CCGCGGCGAGGCGCAGGCGGCGG + Exonic
1037878665 8:22561952-22561974 CCGCGCCCCTCCGCAGCCCTCGG - Intronic
1038152584 8:24956065-24956087 CCGCCGCCAGGCGCAGGTCGCGG + Exonic
1049419571 8:142510823-142510845 CCGCGCCCCGGCCCCGGCCCCGG - Intronic
1049612178 8:143560875-143560897 CCGCAGCCAAGCGCAGGGCTGGG - Intronic
1049668520 8:143859345-143859367 CCAGGCCCAGGCCCAGGCCCGGG - Exonic
1049668936 8:143860947-143860969 CCAGGCCCAGGCCCAGGCCCGGG - Exonic
1049669351 8:143862549-143862571 CCAGGCCCAGGCCCAGGCCCGGG - Exonic
1049669763 8:143864142-143864164 CCAGGCCCAGGCCCAGGCCCGGG - Exonic
1049670178 8:143865750-143865772 CCAGGCCCAGGCCCAGGCCCGGG - Exonic
1049762222 8:144336745-144336767 GCGCGCCCGGGCGCTGGCCGCGG - Intergenic
1050160982 9:2718399-2718421 GCGCGCGCAGGCGCAGGTCGAGG + Exonic
1051170453 9:14315003-14315025 CCGCGCCCCAGCCCCGGCCTGGG - Intronic
1054155166 9:61634829-61634851 CCGCGCCCTCGCCCAGGACTCGG - Intergenic
1056928588 9:90855428-90855450 CCTCGTCCAGGAGCAGGCCCTGG - Intronic
1057186162 9:93058655-93058677 CCTCACCCAGGCCCAGGCCCAGG + Intergenic
1057225295 9:93289666-93289688 CGGAGCCCGGGCGCAGGCCCGGG + Intronic
1057623326 9:96655404-96655426 CCGCGGCGCGGCGCGGGCCTGGG + Intergenic
1057869686 9:98708606-98708628 CCGCGCCCAGCCCCAGGCCCCGG + Exonic
1061293713 9:129666168-129666190 CCGCGCCCCGGCCCCGGCCCCGG - Intronic
1062042834 9:134412003-134412025 CAGCACCCAGACGCAGGCCGGGG - Intronic
1062567465 9:137169718-137169740 GCGCGCGCAGGCGCAGGCTCAGG + Exonic
1185464123 X:345286-345308 ACGCCCCCAGGCAGAGGCCTCGG + Intronic
1185774949 X:2794571-2794593 ACCCGCCCAGGCCCAGGCCACGG + Exonic
1186473043 X:9836123-9836145 CCTGGCCCAGGCCCAGGCCCAGG + Intronic
1187449119 X:19381436-19381458 CCCCTGCCAGGCTCAGGCCTTGG + Intronic
1189262656 X:39689247-39689269 CCGGGGGCAGCCGCAGGCCTTGG - Intergenic
1192265638 X:69535769-69535791 CCAGGCCCAGGCCCAGGCCCTGG + Intergenic
1197753446 X:129980553-129980575 CCGGGTCCAGGTGCCGGCCTCGG - Intergenic
1198276276 X:135098207-135098229 CCGCGGCCAGGGCCAGGGCTGGG + Intergenic
1200084942 X:153599330-153599352 GCGCGCGCAGGCGCAGGCGCAGG + Intronic
1200234154 X:154460152-154460174 CCGCGCCTGGGGACAGGCCTAGG - Exonic
1201190311 Y:11438540-11438562 CCTTGCCCAGGCACTGGCCTTGG + Intergenic
1201575370 Y:15456436-15456458 CTGCCCCCAGGCGAGGGCCTCGG - Intergenic