ID: 968634108

View in Genome Browser
Species Human (GRCh38)
Location 4:1669026-1669048
Sequence GTGGTAGTTTTGAAAATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968634108_968634113 8 Left 968634108 4:1669026-1669048 CCTCCCATTTTCAAAACTACCAC 0: 1
1: 0
2: 0
3: 15
4: 212
Right 968634113 4:1669057-1669079 TCTTCTGGAAAATCTAATCACGG 0: 1
1: 0
2: 1
3: 20
4: 300
968634108_968634111 -7 Left 968634108 4:1669026-1669048 CCTCCCATTTTCAAAACTACCAC 0: 1
1: 0
2: 0
3: 15
4: 212
Right 968634111 4:1669042-1669064 CTACCACGCGAGTTCTCTTCTGG 0: 1
1: 0
2: 0
3: 0
4: 21
968634108_968634116 26 Left 968634108 4:1669026-1669048 CCTCCCATTTTCAAAACTACCAC 0: 1
1: 0
2: 0
3: 15
4: 212
Right 968634116 4:1669075-1669097 CACGGTGGTCTTCTGGCTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 59
968634108_968634114 11 Left 968634108 4:1669026-1669048 CCTCCCATTTTCAAAACTACCAC 0: 1
1: 0
2: 0
3: 15
4: 212
Right 968634114 4:1669060-1669082 TCTGGAAAATCTAATCACGGTGG 0: 1
1: 0
2: 0
3: 8
4: 91
968634108_968634115 19 Left 968634108 4:1669026-1669048 CCTCCCATTTTCAAAACTACCAC 0: 1
1: 0
2: 0
3: 15
4: 212
Right 968634115 4:1669068-1669090 ATCTAATCACGGTGGTCTTCTGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968634108 Original CRISPR GTGGTAGTTTTGAAAATGGG AGG (reversed) Intronic
900546322 1:3231266-3231288 ATGGCAGTCTTGAAAACGGGTGG + Intronic
906686509 1:47766550-47766572 GCGGTAGTTATGATAATGGCAGG - Intronic
910109783 1:83670277-83670299 CTGATGGTTTTAAAAATGGGAGG + Intergenic
910143012 1:84047309-84047331 GTGGAAGTGGTGAAAAGGGGTGG - Intergenic
911007747 1:93244195-93244217 CTGATGGTTTTAAAAATGGGAGG - Intronic
912042253 1:105406905-105406927 GTGGTAGCTATAAAAATGGTAGG + Intergenic
914732035 1:150380142-150380164 GTGATAGTTTATAAAATGGTGGG - Intronic
915664977 1:157436284-157436306 GTGGAAATTTTGAAAGTCGGAGG + Intergenic
917831075 1:178886980-178887002 GGAGTAGATTTGAAAATGAGAGG + Intronic
917854773 1:179091381-179091403 GTGGTGGTCCTGAAGATGGGAGG + Intronic
918543031 1:185652302-185652324 GTTGAAGTTTTAAAAAGGGGTGG + Intergenic
919404463 1:197160922-197160944 TTGTTAGCTTTGAAAATGGAAGG + Intronic
919672659 1:200351864-200351886 GTGGAAGATTTGAAAATCTGGGG - Intergenic
919709896 1:200715994-200716016 GTTGTAGTATTAAATATGGGTGG + Intergenic
919882840 1:201912152-201912174 GTGGAAGTTTGGTAAATGGATGG + Intronic
919943058 1:202301556-202301578 TTGGGAGTTTTGAATATGGTGGG + Intronic
920089674 1:203443338-203443360 GTGGGAGTTTTGGAAAGGAGAGG - Intergenic
920098166 1:203499999-203500021 GTGGTAGGTGTGGAAGTGGGTGG - Intronic
920275592 1:204802115-204802137 GTGGGAGTTGAGGAAATGGGTGG + Intergenic
920394972 1:205638448-205638470 GGGGAAGTTTTCTAAATGGGTGG - Intergenic
920896715 1:210058325-210058347 GTTGGAGTTTTGAAGTTGGGAGG + Intronic
921095552 1:211884515-211884537 GAAATAATTTTGAAAATGGGAGG + Intergenic
922684282 1:227627143-227627165 TTGATAGTTTTGAAAAGGTGTGG + Intronic
922887719 1:229032649-229032671 GTGATAGTTTGGAAAGTGGGAGG + Intergenic
923861127 1:237893023-237893045 ATGTGAGTTTTGACAATGGGTGG + Intergenic
1063254409 10:4310470-4310492 GTGGTAGTTTAGAACAGGGGTGG + Intergenic
1063806184 10:9644644-9644666 GTAGTAGTATTGAAAATATGAGG + Intergenic
1065642959 10:27803843-27803865 GTAGCAGTTCTGGAAATGGGGGG + Intergenic
1066424459 10:35293370-35293392 TAGATAGTTTTGAAATTGGGAGG + Intronic
1067940312 10:50649769-50649791 GTCGTAGTTTTGGAAATGGAAGG - Intergenic
1069332183 10:67305708-67305730 GTGGTAGATGTGAAAGTGGAGGG + Intronic
1069815155 10:71188955-71188977 GTGGTAGTTTATAGAATTGGAGG - Intergenic
1070795616 10:79214706-79214728 CTGGTACTTCTGAAAAAGGGGGG - Intronic
1071364018 10:84880538-84880560 GAAGAAGTTTTGAAAATGGATGG - Intergenic
1073626542 10:105103397-105103419 GTGGTTGTTTTGAGGCTGGGAGG + Intronic
1073803044 10:107064836-107064858 GTGGTTGTCTTGAAGATGGATGG - Intronic
1074354176 10:112767528-112767550 GTGCTAGTTCTGAAAACAGGAGG + Intronic
1076203466 10:128576522-128576544 TTGGCAGTTTTGGAAAGGGGAGG + Intergenic
1077448333 11:2614800-2614822 GTAAAAGTTTTGAAAATGGCAGG + Intronic
1080472113 11:32556419-32556441 GTGGTAGAATGGTAAATGGGAGG + Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083908209 11:65688080-65688102 GTGGTATTTCTGGAAAGGGGTGG - Intergenic
1086227089 11:84525160-84525182 GTTGGAGTTGTGAAAATGGATGG - Intronic
1089681659 11:120122039-120122061 GGGGTTGTTTTCAAACTGGGTGG + Intronic
1090854612 11:130600722-130600744 CTGGTTGTTTTTAAAATGTGTGG - Intergenic
1091009627 11:131987077-131987099 GTGGTAGTTCTAAAAACAGGTGG + Intronic
1092281918 12:7104164-7104186 GGGGAAGTTTTAAAAATTGGGGG + Intronic
1093573811 12:20701442-20701464 ATGGTAGTTTTGAAATTGGTAGG + Exonic
1094073691 12:26449379-26449401 GTAGATGTTTTGAAAATAGGAGG - Intronic
1094234174 12:28144829-28144851 GTGGTAGTTTATAACATGAGGGG - Intronic
1095189805 12:39244489-39244511 GTGGCAGTATTCAAACTGGGAGG - Intergenic
1095529913 12:43174952-43174974 GTAGTAGTTTTGATAATGATAGG - Intergenic
1097979500 12:65723496-65723518 GTGTTATTTTTGAAAATGTACGG - Intergenic
1099477847 12:83129586-83129608 GAGGTAGATGTGAAAATGGATGG - Intronic
1100081920 12:90862919-90862941 GTGGTAGTTGTCAAAAGGAGTGG + Intergenic
1103803522 12:123555199-123555221 TTGGTAGTTTTGAAAAGGCCTGG - Intergenic
1104624431 12:130339616-130339638 GAGGTGGTTTTGAAACTGGAAGG + Intronic
1105818219 13:24056313-24056335 TTGGAAGTTTTGGAAAGGGGTGG + Intronic
1106326860 13:28699873-28699895 ATGGTAACTTCGAAAATGGGAGG + Intergenic
1106974393 13:35189960-35189982 GTGGTAGCTTTGAAAACCAGAGG + Intronic
1109160977 13:58973982-58974004 GTTGTACTTTTAAAAATGTGGGG - Intergenic
1109285603 13:60404942-60404964 CTGATGGTTTTAAAAATGGGAGG + Intronic
1109548242 13:63858189-63858211 GTGTTTGTGTGGAAAATGGGTGG - Intergenic
1112206900 13:97333287-97333309 TTGGTAGTTTTGAAAACTTGGGG + Intronic
1112686633 13:101835973-101835995 GTTGTACTTTTAAAAATGGGGGG + Intronic
1114792670 14:25677550-25677572 ATGGTAGTTTTTAAAATCAGTGG + Intergenic
1115201516 14:30859061-30859083 GTGGTTGTTTTAAAAGTGTGTGG - Intergenic
1116631103 14:47334969-47334991 GGAGTAGCTTTGAAATTGGGTGG + Intronic
1116895878 14:50314261-50314283 GTGATGGTTTTAAAAACGGGAGG + Intronic
1121027909 14:90629996-90630018 GTACTGGTTGTGAAAATGGGGGG + Intronic
1122331056 14:100913538-100913560 GTTGTTGTTTTGAAGTTGGGTGG + Intergenic
1122390999 14:101384164-101384186 CTGGAATCTTTGAAAATGGGGGG - Intergenic
1125167425 15:36724290-36724312 GTGGTAGTAGTGGAAATGGAAGG + Intronic
1126229920 15:46312533-46312555 GTGGTAGTTTTAAAACAGGAAGG + Intergenic
1126992340 15:54394219-54394241 GGGGGACTGTTGAAAATGGGTGG - Intronic
1128074384 15:64817162-64817184 GTGGTGGCTTAGAAAATGGTGGG + Intronic
1129529295 15:76249807-76249829 GCGGTAGTTCTGAAGATGGGTGG - Intronic
1129975829 15:79820933-79820955 GTGGTGGTTGTGAAAATAAGTGG - Intergenic
1130319470 15:82828646-82828668 GTGGGTGATATGAAAATGGGAGG + Intronic
1130619132 15:85443035-85443057 GTGGTAGGTTTGAAAAGTTGGGG + Intronic
1133491803 16:6277365-6277387 GTGGGAGGATTGAATATGGGAGG + Intronic
1134837705 16:17375918-17375940 GTGGCAGTGTTGAAAAGGGACGG + Intronic
1138389737 16:56661671-56661693 ATGGCAGTTTTGAAAATGAGGGG + Intronic
1143150112 17:4802394-4802416 GTGGTAGTTTTGCCCATGGTGGG - Intergenic
1146309756 17:31758620-31758642 GTGGTGGTTTTGGAACTAGGGGG - Intergenic
1146981391 17:37165128-37165150 ATGGTACTTTTTAAGATGGGGGG - Intronic
1147359307 17:39921246-39921268 GTGTTAATTTTGAAAAGGTGTGG - Intronic
1148193092 17:45693419-45693441 CTGTTATTTTTGTAAATGGGTGG - Intergenic
1148341753 17:46877445-46877467 GTGGTAGTTTTGAGCACGGCTGG - Intronic
1148939554 17:51196486-51196508 GTCTTAGTTTTAAAAAGGGGGGG - Intronic
1150631421 17:66883023-66883045 GTGGTAGATTGAAAAATGGATGG - Intronic
1152052204 17:77989114-77989136 GTGGCAGTTCTGAAGAAGGGAGG + Intergenic
1153317670 18:3740898-3740920 GTGGTGGTGTTGGTAATGGGTGG - Intronic
1155194256 18:23458397-23458419 GTGGCAGTTTTGCAAAGGAGAGG + Intronic
1155830668 18:30512330-30512352 CTGATGGTTTTGTAAATGGGAGG + Intergenic
1156358442 18:36362433-36362455 GAGGCAATTTTGAAAAGGGGAGG + Intronic
1157094020 18:44670338-44670360 GAGGTATTTCTGAAAATGGTTGG - Intergenic
1160305066 18:77725166-77725188 CTGATGGTTTTAAAAATGGGAGG + Intergenic
1164080213 19:21855845-21855867 GAGGTACTTTTGAAAAAGTGAGG - Intergenic
1164126142 19:22321052-22321074 GTTGTTGTTTTAAAAATGTGTGG + Intergenic
1168268157 19:55234249-55234271 TAGTAAGTTTTGAAAATGGGAGG - Intronic
1168312171 19:55465834-55465856 GTGGTAGTGTTGAGCATGGCAGG - Intergenic
925187178 2:1856545-1856567 GTTATGGTTTTGTAAATGGGAGG - Intronic
925587102 2:5475170-5475192 GTGGTAGTTTAGAAAGTGCAGGG - Intergenic
925933932 2:8734999-8735021 TAGGTAGTTTTGGAAATAGGAGG - Intronic
926169142 2:10540178-10540200 TTGGTAGTTTAGAAAAGGGAGGG - Intergenic
928733769 2:34261860-34261882 GTGGTAGTATAGAGAATGGATGG - Intergenic
929507955 2:42543111-42543133 GTGGGAGTCTTTAAACTGGGTGG + Intronic
930145528 2:47999042-47999064 TTTGTAATTTTGAAAATGGATGG + Intergenic
931638754 2:64363146-64363168 GTGGAAGTTCTGACAGTGGGAGG - Intergenic
934871430 2:97870017-97870039 GTGCTGCTTTTGAAAATGGTAGG - Intronic
935557260 2:104523474-104523496 GAGGAAGTTCTGAAGATGGGTGG + Intergenic
938271155 2:129973120-129973142 GTGCTATTTTTGATGATGGGGGG - Intergenic
939493264 2:142901149-142901171 TTGTTAGTTTTGAAAAAGCGTGG + Intronic
942448566 2:176094005-176094027 GTGATGTCTTTGAAAATGGGGGG - Intronic
943011889 2:182460242-182460264 CTGGGAGTATTGAAAATGAGAGG - Intronic
943735284 2:191347243-191347265 TTGATAGTTTAGAAAATGGCAGG + Intronic
944220731 2:197301852-197301874 GTTTTGGTTTTTAAAATGGGGGG + Intronic
945728243 2:213500346-213500368 GTGGTCTTATTGAAAAAGGGAGG - Intronic
946996782 2:225401487-225401509 CTGGTAGTTTTGAATTTTGGGGG - Intronic
947018453 2:225647421-225647443 GTGGTATTTTCAAGAATGGGTGG + Intronic
948302050 2:236914817-236914839 GAGGTAATGTGGAAAATGGGGGG + Intergenic
948416228 2:237806848-237806870 CAAGGAGTTTTGAAAATGGGTGG + Intronic
948473425 2:238201852-238201874 GTGGTTATTTTGAAAATGAATGG + Intronic
1170445802 20:16426222-16426244 TTGGCAGTTTTGAAAATAGTAGG - Intronic
1170695171 20:18651456-18651478 CTGGTAGTTTTAAAAATTGTTGG + Intronic
1173074800 20:39807460-39807482 ATGGTAGCTTTGAAGATGGAGGG + Intergenic
1173094457 20:40011794-40011816 ATGGTAATTTTGCCAATGGGAGG - Intergenic
1175857643 20:62131131-62131153 CTGGGAGGTGTGAAAATGGGTGG + Intronic
1177257326 21:18682500-18682522 GTGGTAGTTCTGAATATTTGTGG + Intergenic
1177583501 21:23058914-23058936 TTGCTGGTTTTGAAAATGGAAGG + Intergenic
1178605336 21:34031415-34031437 CTGGTAGAATTGAAAATGAGTGG + Intergenic
1179660818 21:42873762-42873784 GTGGTAATTTCTAACATGGGAGG + Intronic
1182084501 22:27551990-27552012 CTGGTTGTTTTAAAAATGTGTGG + Intergenic
1182743213 22:32583968-32583990 GTGGTTGTTTTCAAACTGGTTGG - Intronic
1184901625 22:47449930-47449952 GTGCTGGTTTTGAAAATGGAAGG - Intergenic
1185374043 22:50474230-50474252 GTGTTTGATTTGAAACTGGGAGG - Intronic
949731523 3:7118567-7118589 GTGGTTAATTTGAAAATTGGAGG + Intronic
951127893 3:19005470-19005492 GTACTAGTATTCAAAATGGGAGG + Intergenic
951340219 3:21476974-21476996 GTGGTGGTTATAAAAATGGGTGG - Intronic
952072648 3:29657213-29657235 CTGGTAGATTATAAAATGGGAGG - Intronic
952727659 3:36605084-36605106 GTGGGAGTTGTGAGAGTGGGTGG - Intergenic
955795025 3:62626946-62626968 GTGTCAGATTTGAAAAAGGGAGG + Intronic
955893121 3:63671227-63671249 GTGCTAGTTTTCAGAATTGGTGG + Intronic
955987141 3:64585345-64585367 GAGGTAGTTGTGAGAATGAGGGG + Intronic
956478374 3:69647746-69647768 GTGGTGGTGGTGACAATGGGAGG - Intergenic
957940473 3:86996731-86996753 TTGCTAGTTTTGAAAATAGAGGG + Intergenic
960259784 3:115553840-115553862 GTGGTAGTTGGGAAAAATGGAGG + Intergenic
960704896 3:120472539-120472561 CTGTTAGTTTTGAAGATGGTGGG + Intergenic
960748516 3:120918090-120918112 GGGCTGGTTTTGAAGATGGGAGG - Intronic
961334040 3:126159567-126159589 CTGGTAGTTTTGAGAGAGGGTGG + Intronic
961480813 3:127178886-127178908 TTGGTAGACTTGAAACTGGGAGG + Intergenic
963269807 3:143274849-143274871 GCAGGAGTTTTGTAAATGGGAGG - Intronic
964630381 3:158803076-158803098 GTGGTAGTCTTGACAGTGGTTGG + Intronic
965054396 3:163695600-163695622 TTGATAGTTTTGAAAATGCCTGG + Intergenic
968634108 4:1669026-1669048 GTGGTAGTTTTGAAAATGGGAGG - Intronic
970325380 4:14918614-14918636 TTGCTAGTTTAGAAAATGGAAGG - Intergenic
970547990 4:17149030-17149052 CTGATAGTTTTAAAAAGGGGAGG + Intergenic
970920881 4:21393458-21393480 GTGGCCTTTCTGAAAATGGGTGG - Intronic
971184812 4:24364080-24364102 GTGGCAGTTGTTAAAATGGGTGG - Intergenic
973944773 4:55945252-55945274 CTGGGAGCTTTGAAAATGGTAGG + Intergenic
974338265 4:60579869-60579891 GTGTTACTTTTTAAAATAGGAGG - Intergenic
974474776 4:62364364-62364386 GTGGTGGTGTTGGAAAAGGGAGG + Intergenic
976349994 4:84050457-84050479 GTCTTTGTTTTGAAAAAGGGTGG - Intergenic
980996965 4:139788524-139788546 TTGGTAACTTTAAAAATGGGAGG - Intronic
981029486 4:140109923-140109945 GTGGGAATTTTGACAATGAGTGG - Intronic
982147777 4:152416332-152416354 GTAGTACTTTTGAAACTGGTAGG + Intronic
982777748 4:159459272-159459294 TTGGTTGTTTTGAAAGTGGGTGG + Intergenic
985319429 4:188693150-188693172 GTTGTAGTTATGAATATAGGAGG - Intergenic
985779606 5:1863334-1863356 GTGGCAGTGTTGAAAGTGGGGGG + Intergenic
986622725 5:9692298-9692320 TTGGTACTTCTGAAAATGGAAGG + Intronic
987773418 5:22335336-22335358 CTGATGGTTTTAAAAATGGGTGG + Intronic
989949068 5:50275504-50275526 GTGATGGTTTTGGAGATGGGGGG - Intergenic
990233525 5:53740989-53741011 ATGTTAGTATTGAAAATGTGGGG - Intergenic
990256530 5:53976341-53976363 GTTGTAGTTTCCTAAATGGGTGG - Intronic
990432328 5:55747989-55748011 GAGGTAGTTTCCAAAATGTGAGG + Intronic
992696205 5:79290298-79290320 TAGGTATTTTTGAAAATGAGTGG + Intronic
996940645 5:129001181-129001203 TTGGTAGTATTTAAAATGAGTGG - Intronic
1000039267 5:157473008-157473030 CAGGTGGTTTTGAAATTGGGAGG - Exonic
1000998828 5:167985922-167985944 GTGGTAGCTTTGAGAAGCGGAGG - Intronic
1002638626 5:180620077-180620099 GTGCAAGTTTTGAAAATGGAGGG + Intronic
1003005399 6:2376530-2376552 GTGTTAGTTGTGTATATGGGGGG - Intergenic
1005529886 6:26692407-26692429 TTGGGAGTTTTGAACCTGGGTGG - Intergenic
1005540910 6:26809240-26809262 TTGGGAGTTTTGAACCTGGGTGG + Intergenic
1007761927 6:44138387-44138409 GAGGTAATTATGAGAATGGGTGG + Intronic
1008810108 6:55486576-55486598 GTGCAAGTTTGGAAAATAGGTGG - Intronic
1009011726 6:57851328-57851350 TTGGGAGTTTTGAACCTGGGTGG + Intergenic
1011527493 6:88280943-88280965 CTGGTTGCTTTGAAAATGGATGG + Intergenic
1016123866 6:140375044-140375066 GAGCTAGTATTGAAAATGTGGGG + Intergenic
1019111539 6:169720696-169720718 GTGAAAGTTTTGGAAATGGATGG + Intronic
1021291815 7:18854726-18854748 GGGGTAATTTTTTAAATGGGTGG + Intronic
1022199602 7:28103726-28103748 GTGGTAGTTGTGAAGGTGGTGGG - Intronic
1026241632 7:68580700-68580722 CTGATGGTTTTAAAAATGGGAGG - Intergenic
1028088572 7:86668822-86668844 GTGGTGATTTTAGAAATGGGAGG + Intronic
1028627298 7:92891435-92891457 GTGGGAGGATGGAAAATGGGGGG + Intergenic
1028644113 7:93076449-93076471 GAGGTTGTTTTTAAAATGGCAGG - Intergenic
1029286132 7:99467352-99467374 GAGGTTGTTTTAAAAATCGGAGG - Intergenic
1037090378 8:14908284-14908306 GTCCTTGTTTTGAAAATGAGGGG + Intronic
1039250997 8:35663854-35663876 GTGGTTGATTTGAAAATATGAGG + Intronic
1039400185 8:37262646-37262668 GTGCCAGTTTTGCAAAAGGGCGG + Intergenic
1041541085 8:58985888-58985910 ATGGAGGTTTTAAAAATGGGAGG - Intronic
1041912455 8:63103375-63103397 GTGGGAGATTAGAAGATGGGGGG - Intergenic
1043672702 8:82908013-82908035 CTGCTGGTTTTGAAAATGGAGGG + Intergenic
1045932578 8:107644200-107644222 CTGATAGTTTTATAAATGGGAGG + Intergenic
1046119419 8:109827101-109827123 ATGGTAGTTTTGAATTTCGGTGG - Intergenic
1047085090 8:121507114-121507136 GTGGTAGCACTGAAAATTGGTGG + Intergenic
1048045984 8:130773859-130773881 CTGATGGTTTTAAAAATGGGAGG + Intergenic
1049084765 8:140470179-140470201 GTGGTACTTTTTGAAGTGGGAGG - Intergenic
1052862313 9:33444643-33444665 GTGGTAGTGGTGGCAATGGGCGG + Intronic
1056439112 9:86602834-86602856 GTGGAATTGTTGGAAATGGGTGG + Intergenic
1058077232 9:100663418-100663440 GAGGTAGTTTTGCAACTTGGAGG + Intergenic
1060653434 9:125351183-125351205 CTGATGGTTTTGAAAAAGGGGGG - Intronic
1060706785 9:125809953-125809975 ATGCTTGTTTTGAAAATGTGAGG + Intronic
1187265992 X:17734201-17734223 GTGGTAGTTGGGAAAGTAGGAGG + Exonic
1187710149 X:22045051-22045073 GGGGGAGGTTTGAAAATGGTGGG + Intronic
1187726223 X:22205042-22205064 GTGATAGTTTTGTTAAGGGGTGG - Intronic
1187896192 X:23981825-23981847 GTGGTGGTTGTGGAAATGGAGGG + Intergenic
1190777855 X:53568453-53568475 GTGGTAATTTTTAAAGTGGGGGG + Intronic
1191951740 X:66600368-66600390 TTGCTAGTTTTGAAAATAGAAGG + Intronic
1191986540 X:66987507-66987529 ATGATTGGTTTGAAAATGGGAGG - Intergenic
1194103845 X:89742922-89742944 GTCTTACTTTTGAAAATGTGAGG + Intergenic
1196109397 X:111930055-111930077 ATTGTGGTTTTGAAATTGGGTGG + Intronic
1196568885 X:117242582-117242604 GAGGTAGTTTTGCAAATTGGAGG + Intergenic
1197339708 X:125251597-125251619 GTGCTAATTTTGAAGATGGAAGG - Intergenic
1197403249 X:126019921-126019943 ATGGTAGTTTCTATAATGGGAGG - Intergenic
1198059655 X:133032478-133032500 GTGGAAGTTTTGTAAAAGAGCGG + Intronic
1198962948 X:142202043-142202065 GTGGTAGTTACGAAGCTGGGTGG - Intergenic
1200455799 Y:3390673-3390695 GTCTTACTTTTGAAAATGTGAGG + Intergenic