ID: 968635276

View in Genome Browser
Species Human (GRCh38)
Location 4:1675293-1675315
Sequence TGTGCTTCCCGGAGCTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968635276_968635285 20 Left 968635276 4:1675293-1675315 CCACCTGAGCTCCGGGAAGCACA 0: 1
1: 0
2: 0
3: 16
4: 268
Right 968635285 4:1675336-1675358 GCCCCTACTCCAGGACCTCTCGG 0: 1
1: 0
2: 2
3: 26
4: 237
968635276_968635282 11 Left 968635276 4:1675293-1675315 CCACCTGAGCTCCGGGAAGCACA 0: 1
1: 0
2: 0
3: 16
4: 268
Right 968635282 4:1675327-1675349 GCATCCCTTGCCCCTACTCCAGG 0: 1
1: 0
2: 1
3: 25
4: 241
968635276_968635289 26 Left 968635276 4:1675293-1675315 CCACCTGAGCTCCGGGAAGCACA 0: 1
1: 0
2: 0
3: 16
4: 268
Right 968635289 4:1675342-1675364 ACTCCAGGACCTCTCGGCGCCGG 0: 1
1: 0
2: 0
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968635276 Original CRISPR TGTGCTTCCCGGAGCTCAGG TGG (reversed) Intronic
900141470 1:1140947-1140969 TGTTCTTCGCGGCGCTGAGGCGG + Intergenic
901096534 1:6685136-6685158 TGTACTTCCAGCACCTCAGGAGG + Intronic
901312184 1:8277970-8277992 TGTGGTTCCAGGTACTCAGGAGG - Intergenic
902330866 1:15730704-15730726 CGTGCTTCGTGGTGCTCAGGTGG + Exonic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
907076899 1:51587241-51587263 TGTGCTTCCAGCTCCTCAGGAGG + Intronic
909486636 1:76181027-76181049 TGTGACTCCCGGAGCCCAGTTGG - Intronic
915354948 1:155250463-155250485 CCTGCTTCCCCGAGCTGAGGCGG - Exonic
917216202 1:172680813-172680835 TGTGCTTCCCAGACTTCTGGAGG + Intergenic
918030017 1:180798733-180798755 TGTGATTCCAGGTGCTCAGAAGG - Intronic
919393702 1:197019169-197019191 TGTGGTTCCAGCTGCTCAGGAGG - Intergenic
919834189 1:201562507-201562529 TGTCCTGCCCAGGGCTCAGGAGG - Intergenic
919926410 1:202194038-202194060 TGCGCTTCCCGGAGGGCCGGCGG + Exonic
920015176 1:202901411-202901433 TGTGCTCCCAGCTGCTCAGGAGG - Intronic
921436296 1:215127203-215127225 AGTGCTTCACGGAGCTGAGTTGG + Intronic
922777306 1:228221180-228221202 TGTGGTTCCGGCAACTCAGGAGG - Intronic
924547072 1:245039351-245039373 AGTGCTTCCAGCTGCTCAGGAGG + Intronic
924809221 1:247386614-247386636 TGTGGTTCCAGCAACTCAGGAGG - Intergenic
1062980006 10:1713937-1713959 CGTGCTTCCTGGAGCTCTGAGGG + Intronic
1063129293 10:3163775-3163797 TGTGCATCCCGGAGCTTACATGG - Exonic
1064144305 10:12815518-12815540 TGTGCTCCTCTGAGCTCAGAAGG - Intronic
1064699800 10:18007192-18007214 AGTGCTGCCTGGAGCTAAGGAGG - Intronic
1065338873 10:24684163-24684185 TGTAATTCCAGGAACTCAGGAGG + Intronic
1066165754 10:32787510-32787532 TGTGCTGCCCGAAGTTAAGGAGG - Intronic
1066235554 10:33481079-33481101 TATGCTTCCTGCAGCTCAGTTGG - Intergenic
1067470789 10:46536320-46536342 TGGTCTTCCTGAAGCTCAGGTGG - Intergenic
1067681529 10:48444967-48444989 TCTGGATGCCGGAGCTCAGGAGG - Intergenic
1069677932 10:70261900-70261922 TGTGGTTCCAGCTGCTCAGGAGG - Intronic
1070262749 10:74873341-74873363 TGTGGTTCCAGCTGCTCAGGAGG + Intronic
1070383590 10:75903303-75903325 TGTGCTTCCCGACACCCAGGAGG - Intronic
1073079521 10:100850149-100850171 TGTGCATCCCGCCGCTCATGTGG + Intergenic
1075617917 10:123904938-123904960 TGTGCTTCACAGAGCACAGGAGG - Intronic
1076180854 10:128405933-128405955 TGCGATTCCTGGAGCTTAGGAGG + Intergenic
1076571757 10:131437836-131437858 TGTGCCTCCTGGATCGCAGGGGG + Intergenic
1077102245 11:827476-827498 TGTGCTCCCCGAAACTCTGGGGG - Intronic
1077182368 11:1222557-1222579 TGTGCATGCCTGAGCTCAGCAGG + Intergenic
1077283075 11:1754244-1754266 TGTGCTTCCAGGAGCCCTGAGGG - Intronic
1081851324 11:46277107-46277129 TGTAATTCCAGGTGCTCAGGAGG + Intergenic
1082245324 11:49915055-49915077 TGTGGTTCCAGCTGCTCAGGAGG - Intergenic
1084687908 11:70708058-70708080 TGTGCTTCCAGGGCCTCAGGAGG + Intronic
1085048378 11:73366606-73366628 TGTGGTTCCAGCTGCTCAGGAGG + Intronic
1088735653 11:112725752-112725774 AGTGCTTCAGGGAGCTCAGGAGG + Intergenic
1090334582 11:125954118-125954140 GGTGCCTCCCGTAGGTCAGGCGG - Intergenic
1091329394 11:134719299-134719321 TGTCCTTCCTGGAGCTCTGTAGG + Intergenic
1092279651 12:7089700-7089722 TGTGCTTCCCGGAGCAAATCAGG - Exonic
1095296808 12:40536104-40536126 TGTGATTCCATGAGCTCAGATGG + Intronic
1096224749 12:49859739-49859761 TGTGGTCCCAGGTGCTCAGGAGG + Intergenic
1096502007 12:52069944-52069966 TGAGCTTCCCGGCGCGCGGGGGG + Intronic
1096882279 12:54682805-54682827 TGAGATTCCAGGAACTCAGGAGG + Intergenic
1097405400 12:59183218-59183240 TGTGGTTCCCGCTCCTCAGGCGG + Intergenic
1100511708 12:95281354-95281376 TGTGTTTCCCGCTACTCAGGAGG + Intronic
1101693333 12:107101450-107101472 TGCGTTTCCCTGAGCTCAGGTGG - Intergenic
1101734002 12:107449183-107449205 TGGGCTTCCTGGAGCCCAGCTGG - Intronic
1102864326 12:116361976-116361998 TGTGGTTCCAGGTACTCAGGAGG - Intergenic
1103101242 12:118178066-118178088 TGTGGTCCCAGCAGCTCAGGAGG - Intronic
1103999114 12:124849175-124849197 TTAGCTTCCAGCAGCTCAGGTGG - Intronic
1105743571 13:23354811-23354833 TCTGCTTCCCTGAGCTCTGGAGG + Exonic
1105802821 13:23924029-23924051 TGTGGTTCCCACAACTCAGGAGG - Intergenic
1106111315 13:26779900-26779922 TGTGGTTCCAGCAACTCAGGAGG + Intergenic
1106688615 13:32089651-32089673 TGTGCTTCCAGAGGCTGAGGTGG + Intronic
1106999607 13:35527513-35527535 TGGGCACCCAGGAGCTCAGGAGG - Intronic
1107956144 13:45514068-45514090 TGTGTTTCTCAGATCTCAGGAGG + Intronic
1108567966 13:51719978-51720000 TGTGCTTGCCGGAGCCTAGTCGG - Intronic
1112180715 13:97077198-97077220 TGGGCTTCCCAGAGAACAGGCGG - Intergenic
1112593342 13:100784662-100784684 TGTGCTTCTGGGGGCTCAAGTGG + Intergenic
1113947815 13:114054424-114054446 GTTGCTGCCCGGAGCCCAGGTGG + Intronic
1114334440 14:21673479-21673501 TGTGGTTCCAGCTGCTCAGGAGG + Intergenic
1114551673 14:23536093-23536115 TGTGCTGCCCGGATTTCAGCGGG - Intronic
1119300066 14:73564482-73564504 TGTGGTCCCAGGTGCTCAGGAGG + Intergenic
1120954949 14:90073582-90073604 TGTGCTCCCCGGAGCCCGTGGGG + Intronic
1121134870 14:91487799-91487821 TCTACTTCCCTGGGCTCAGGTGG + Intronic
1121266641 14:92607492-92607514 TGTGGTTCCAGGTACTCAGGAGG + Intronic
1121669442 14:95696602-95696624 TGTATTTCCTGGAGGTCAGGAGG - Intergenic
1122178607 14:99938644-99938666 TCTGCATCCCTGAGCCCAGGTGG - Intronic
1122219403 14:100226691-100226713 TGTGGTTCCAGCAACTCAGGGGG + Intergenic
1122219420 14:100226855-100226877 TGTGCTTCCAGCTACTCAGGAGG + Intergenic
1122282727 14:100633601-100633623 TGTGCTTCCCTGCTCCCAGGAGG + Intergenic
1122613012 14:102998878-102998900 TGTGCTCCCTGGGGCTCACGTGG - Intronic
1122613036 14:102998951-102998973 TGTGCTCCCTGGGGCTCACGTGG - Intronic
1122613060 14:102999024-102999046 TGTGCTCCCTGGGGCTCACGTGG - Intronic
1122613083 14:102999097-102999119 TGTGCTCCCTGGGGCTCACGTGG - Intronic
1122613107 14:102999170-102999192 TGTGCTCCCTGGGGCTCACGTGG - Intronic
1122613130 14:102999243-102999265 TGTGCTCCCTGGGGCTCACGTGG - Intronic
1125746554 15:42001050-42001072 AGGGCTTCCCTGGGCTCAGGGGG - Intronic
1127585338 15:60372813-60372835 TGTGCTTCCAGCTACTCAGGAGG - Intronic
1128706727 15:69842318-69842340 TGTGCTTTCAGGTGCTCCGGAGG + Intergenic
1129509321 15:76109036-76109058 TGTGCTTTCCACAGCTCATGTGG - Intronic
1131399220 15:92111110-92111132 TGTGCTTCCCACAGTTCAGCAGG + Intronic
1132468061 16:86695-86717 TCTGCTCCCCTGAGCCCAGGCGG - Exonic
1132676559 16:1123586-1123608 TGTGCCTCCAGGACCCCAGGAGG + Intergenic
1132807980 16:1784210-1784232 TGTGGTCCCAGGTGCTCAGGAGG - Intronic
1132906706 16:2286201-2286223 GGTGGTTCCAGGAGCTCTGGGGG + Intronic
1133064282 16:3195080-3195102 TGCGCTTCCCGGAGCACGGCTGG - Intergenic
1133121088 16:3608495-3608517 GCTGTTTCCCGGAGCACAGGTGG + Exonic
1134384161 16:13756497-13756519 TGTGCATCCCAGAGCGCAGATGG + Intergenic
1134587692 16:15426270-15426292 TGTGGTCCCAGCAGCTCAGGGGG - Intronic
1135016487 16:18928179-18928201 TGTGGTCCCAGGAACTCAGGAGG + Intergenic
1135322128 16:21504027-21504049 TGTGGTCCCAGGAACTCAGGAGG + Intergenic
1136333605 16:29597159-29597181 TGTGGTCCCAGGAACTCAGGAGG + Intergenic
1137650128 16:50112757-50112779 TGTGATTCCAGCTGCTCAGGAGG + Intergenic
1137753399 16:50883213-50883235 TGTGCTTCCAAAAGCACAGGAGG - Intergenic
1137802958 16:51277839-51277861 TGTTCATCCCAGAGCTGAGGAGG - Intergenic
1139326785 16:66158752-66158774 TGTGGTTCCAGGTACTCAGGAGG + Intergenic
1142191987 16:88722324-88722346 TGTGGTAGCCGGTGCTCAGGGGG + Exonic
1144767412 17:17740178-17740200 TGGGCTTCTCTGTGCTCAGGGGG + Intronic
1146821284 17:35985133-35985155 TGAGCTCCCTGGAGCTCTGGGGG + Intronic
1149496909 17:57124640-57124662 TGTGCTCCCAGCTGCTCAGGAGG - Intergenic
1149928143 17:60722917-60722939 TGTGGTTCCAGCAACTCAGGAGG + Intronic
1151733721 17:75926069-75926091 TGTGCTCCCCGGTGCCCGGGCGG + Exonic
1151926298 17:77200042-77200064 TGTGGTTCCAGCTGCTCAGGAGG + Intronic
1152087865 17:78231541-78231563 TATGCTTCCAGGAGCACGGGTGG + Exonic
1152639855 17:81444892-81444914 TGTGCTGGCCAGGGCTCAGGAGG + Intronic
1153854706 18:9135256-9135278 TGTGCTCCCAGCTGCTCAGGAGG - Intergenic
1155128033 18:22900216-22900238 TGTGGTTCCAGCTGCTCAGGAGG + Intronic
1157725202 18:49958799-49958821 AGGGCTTCCAGGAGCTCAGCAGG - Intronic
1158547419 18:58408067-58408089 AGGGCTTCCTGGACCTCAGGTGG - Intergenic
1159224657 18:65517162-65517184 TGTACTTCCAGCTGCTCAGGAGG - Intergenic
1159665433 18:71153284-71153306 TATGCTTCTCGGAGCTCATGGGG + Intergenic
1159675401 18:71278175-71278197 TGTAGTTCCAGGTGCTCAGGAGG - Intergenic
1160536454 18:79597069-79597091 TGGGCTGCCCGGACCACAGGAGG + Intergenic
1160610973 18:80084793-80084815 TGTGCTTCCAGCTACTCAGGAGG + Intronic
1160614788 18:80116899-80116921 TGTAATTCCAGCAGCTCAGGAGG - Intronic
1161771004 19:6230623-6230645 TGAGCTTCTCGCAGCGCAGGTGG + Exonic
1162843191 19:13371496-13371518 TTTGCTTTCAGGAGCTCATGGGG + Intronic
1163246100 19:16095403-16095425 TGGGCTTCTAGGAGCTCCGGTGG + Intronic
1165846232 19:38819418-38819440 TGTGCAGCCCGGAGGTAAGGCGG - Intronic
1166875480 19:45894533-45894555 TGTGGTCCCAGAAGCTCAGGAGG - Intronic
1166947042 19:46403892-46403914 GCTGCTGCCCGGAGCCCAGGTGG + Intergenic
1166947838 19:46408025-46408047 TTGGCTTCCCGGAGCACAGTGGG + Intergenic
1168143609 19:54406195-54406217 TGTGCTCCCAGCAACTCAGGAGG - Intergenic
1168167695 19:54563107-54563129 TGTCCATCACTGAGCTCAGGAGG - Intergenic
927236567 2:20880463-20880485 TGGGCATCCCTGAGCTCTGGGGG - Intergenic
927685931 2:25170374-25170396 TGTGGTTCCAGGTACTCAGGAGG - Intergenic
929495120 2:42434332-42434354 TGTGCTTCCAGCTGCTCAGGAGG + Intergenic
933112561 2:78422433-78422455 GGTGCTTACCAGAGGTCAGGAGG - Intergenic
933355049 2:81199353-81199375 TGTGCTCCTTGGAGCTCTGGAGG + Intergenic
935179130 2:100674806-100674828 TGTTCTTCCAGGAGCTCCAGTGG + Intergenic
938400477 2:130987038-130987060 TGTGCTTCCCAGCACTCAAGAGG - Intronic
940342062 2:152591682-152591704 TGTGGTCCCCGGTACTCAGGAGG + Intronic
943249077 2:185494371-185494393 TCTGCTCCCCTGAGATCAGGTGG - Intergenic
943631632 2:190259478-190259500 TGTGGTTCCAGCTGCTCAGGAGG - Intronic
944469686 2:200039789-200039811 TGTGCTTCCAAGTGCTCTGGGGG - Intergenic
945051115 2:205825125-205825147 TGTGCTTCCAGCTACTCAGGAGG + Intergenic
945252545 2:207776741-207776763 TGTGGTTCCAGCTGCTCAGGAGG + Intergenic
945357467 2:208856999-208857021 TGTGCTTTCCCCAGCTCAAGGGG + Intergenic
946234402 2:218314341-218314363 TGTGCTTCCAGCTGCTCAGGAGG - Intronic
947013349 2:225590250-225590272 GGTCCTTCCAGCAGCTCAGGAGG + Intronic
947285812 2:228513002-228513024 TGTGGTTCCAGCTGCTCAGGAGG + Intergenic
947487141 2:230561724-230561746 TGTGGTTCCTGCAACTCAGGAGG + Intergenic
947727791 2:232410522-232410544 GGTGCTCCTCGGAACTCAGGTGG - Exonic
948391319 2:237613440-237613462 TGTGCATACCTGATCTCAGGAGG - Intergenic
1169166211 20:3426311-3426333 TGTGGTCCCAGGTGCTCAGGAGG + Intergenic
1171462193 20:25304398-25304420 GGGGCTTTCCTGAGCTCAGGTGG - Intronic
1172221266 20:33276652-33276674 GGTGCTTTCTGAAGCTCAGGAGG - Intronic
1172958009 20:38775652-38775674 TGTGGTTCCAGCTGCTCAGGAGG + Intergenic
1174586705 20:51614420-51614442 TGTGCTCCCAGCTGCTCAGGAGG - Intronic
1174627262 20:51926150-51926172 TGTGCTTGCCTGAACCCAGGAGG + Intergenic
1174730032 20:52907110-52907132 TGTACTTCCAGCTGCTCAGGAGG + Intergenic
1176300530 21:5096913-5096935 AGTGCTCCCCGGAGCTGGGGAGG + Intergenic
1177977879 21:27873153-27873175 TGTGCTTTCCATAGCTCTGGTGG + Intergenic
1178327997 21:31660546-31660568 TCTGGCTCCCGGAGCTTAGGAGG - Intronic
1178870925 21:36374671-36374693 TGTGCTTCCAGCTACTCAGGAGG + Intronic
1179093907 21:38294082-38294104 TGGGGTTCACTGAGCTCAGGAGG - Intronic
1179721290 21:43317419-43317441 TGTGGTCCCAGGAACTCAGGAGG - Intergenic
1182360943 22:29746092-29746114 TGTGGTTCCAGCTGCTCAGGAGG - Intronic
1182671794 22:32002314-32002336 TGTAGTTCCAGGAACTCAGGAGG - Intergenic
1182687249 22:32130743-32130765 TGTGCTTGCAGGAGCTGAGATGG + Intergenic
1182876253 22:33693700-33693722 TGTGGTCCCAGCAGCTCAGGAGG + Intronic
1183708205 22:39487800-39487822 TGCGCTCCCGGGCGCTCAGGAGG - Exonic
1184392485 22:44212473-44212495 GGGGCTTCCTGCAGCTCAGGCGG - Intronic
1184707780 22:46226749-46226771 TGTGGTTCCAGCCGCTCAGGAGG + Intronic
1185232123 22:49689331-49689353 TGTACTTCCTGGAGCTCTGAGGG - Intergenic
950767063 3:15280731-15280753 TGGGTTTCCCTGAGCTCAGCAGG + Intronic
952915327 3:38233788-38233810 TGTGGTTCCAGCTGCTCAGGAGG + Intronic
953022616 3:39125352-39125374 TGTGCTTCCTGGACATCAGGAGG - Exonic
953540997 3:43818047-43818069 TGTGCTTCCAGGAACTGAGGAGG + Intergenic
954286946 3:49625868-49625890 GGTGCTTCCCAGAGCCCAGCTGG - Intronic
954368475 3:50158175-50158197 TGTGCCTCCCAGACCTGAGGAGG + Intronic
955338267 3:58104861-58104883 ACTGCTTCTGGGAGCTCAGGTGG - Intronic
955757765 3:62243029-62243051 TGTGCTTCCGGCAGCTCATTAGG + Intronic
957193302 3:77038854-77038876 TGAGCTTCCATGAGCTCAGCTGG + Intronic
962315587 3:134357550-134357572 TCTGGTCCCAGGAGCTCAGGAGG - Exonic
963778742 3:149465644-149465666 TGTGCTTCCAGCTGCTCAGTGGG + Intergenic
965759526 3:172061045-172061067 GCTGGTTCCAGGAGCTCAGGAGG - Intronic
965861282 3:173154063-173154085 TGTGGTTCCAGCTGCTCAGGAGG - Intergenic
967608886 3:191481402-191481424 TGTGCTGCCTGGAGTTGAGGAGG - Intergenic
967685362 3:192410178-192410200 TGTGCTTCCCAGCGCTCCAGGGG - Intronic
968635276 4:1675293-1675315 TGTGCTTCCCGGAGCTCAGGTGG - Intronic
969608520 4:8214244-8214266 TGCCCTTCCCAGAGCTCACGTGG - Intronic
971286073 4:25291135-25291157 TGTGCAACCCGCAGATCAGGAGG - Intergenic
973643966 4:52931809-52931831 TATGCTTCCTGGAGGGCAGGAGG - Intronic
973652917 4:53014668-53014690 AGTCCTTCCTGGAGCTCACGGGG - Intronic
974267057 4:59598822-59598844 TGTGCTGCCTGGAGCTGGGGAGG - Intergenic
976224994 4:82788821-82788843 TGTGCTGCCCGGAACTCTGGCGG + Intronic
976294579 4:83456709-83456731 TGTGCTTTCCAGGGCTTAGGGGG - Intronic
976405895 4:84659952-84659974 TGTGGTTCCAGCAACTCAGGAGG + Intergenic
978164201 4:105587193-105587215 AGTGCTTCGGGAAGCTCAGGTGG + Intronic
982127741 4:152198963-152198985 TGTGATCCCAGGAACTCAGGAGG + Intergenic
983697651 4:170552425-170552447 TGTGGTTCCAGCAACTCAGGAGG + Intergenic
983725893 4:170925558-170925580 TGTGCTCCCAGCAACTCAGGAGG - Intergenic
985759924 5:1743247-1743269 TGAGCTTCCAGCAGCTCAAGAGG + Intergenic
985941483 5:3140028-3140050 TGTGCTTCCAGCTACTCAGGAGG + Intergenic
986662101 5:10068462-10068484 TTGGCTTCCAGGGGCTCAGGTGG - Intergenic
987192205 5:15489959-15489981 GTTGCTTCCCAGAGCTCAGCTGG - Intergenic
990466255 5:56074489-56074511 TGTGGTCCCAGCAGCTCAGGAGG - Intergenic
990874414 5:60468258-60468280 TGTGGTTCCAGGTACTCAGGAGG - Intronic
992516461 5:77498695-77498717 TGTGGTTCCAGTAACTCAGGAGG + Intronic
992891428 5:81207830-81207852 TGTTCTCCCCAGCGCTCAGGAGG - Intronic
995287031 5:110401450-110401472 TGTGTTGCCAGTAGCTCAGGAGG - Intronic
995399320 5:111722349-111722371 TGTGCAGCCCTGAGCTCAGCTGG + Intronic
995560745 5:113378602-113378624 TGTGCTTCTCAGAGCTTTGGGGG - Intronic
1000988036 5:167882280-167882302 TCTGATTCCCTAAGCTCAGGAGG + Intronic
1001690383 5:173628557-173628579 TATGGGTCCCTGAGCTCAGGAGG + Intergenic
1002211903 5:177604366-177604388 TCTTCTTCCCAGTGCTCAGGGGG - Exonic
1002946529 6:1766602-1766624 TGAGCTTCCCTGGGCTCCGGAGG - Intronic
1003430624 6:6033963-6033985 TGTGCTTCCCCAACCTCAGTTGG - Intergenic
1004512145 6:16291787-16291809 TGTACTCCCAGCAGCTCAGGAGG + Intronic
1006985466 6:38172873-38172895 TCTCGTTCCCGGAGCACAGGAGG + Exonic
1008276629 6:49550736-49550758 CGCGCTTTCCGGAGCTCAGCAGG + Exonic
1009701862 6:67194500-67194522 TGTGTTTGCCAGAGTTCAGGTGG + Intergenic
1010284146 6:74055505-74055527 TGTGGTTCCAGCTGCTCAGGAGG + Intergenic
1015918887 6:138247138-138247160 TGGGCTTCCCCTTGCTCAGGAGG + Intronic
1019291223 7:251394-251416 TGTGATTCCAGCAACTCAGGAGG + Intronic
1019539379 7:1544980-1545002 TCTGCCGCCCGGAGCCCAGGCGG + Exonic
1020196362 7:6042541-6042563 TTTGCTACAAGGAGCTCAGGAGG - Intronic
1021956741 7:25832777-25832799 TGTGATTCCCAGAGCTTAGAGGG - Intergenic
1022729934 7:33012967-33012989 TGTGGTTCCAGGTACTCAGGAGG - Intergenic
1024252965 7:47520180-47520202 TGTGCTTCACGGAGCCCACGTGG - Intronic
1025201319 7:56963639-56963661 TTTGCTACAAGGAGCTCAGGAGG - Intergenic
1025670625 7:63613294-63613316 TTTGCTACAAGGAGCTCAGGAGG + Intergenic
1026184160 7:68068796-68068818 TGTGGTTCCAGCTGCTCAGGAGG + Intergenic
1027408385 7:77886922-77886944 TGTGGTCCCAGGTGCTCAGGAGG + Intronic
1029665429 7:101992194-101992216 TGTGCTTTAAGGAGCTCAGTAGG - Intronic
1030351478 7:108493040-108493062 TGTTCTTGCCGGAGCTCACTTGG - Intronic
1034164235 7:149013427-149013449 AGTGCTTCCAGAAGCTGAGGCGG + Intronic
1035939171 8:3876729-3876751 TGTGCTTCCAGGTACTCAGGAGG - Intronic
1036559928 8:9892988-9893010 TGTGGTCCCAGCAGCTCAGGAGG - Intergenic
1037318702 8:17623750-17623772 TGTGCTCCCAGCTGCTCAGGAGG + Intronic
1037711625 8:21359870-21359892 TGTGCTTCTCTGAGAACAGGTGG - Intergenic
1038351790 8:26782741-26782763 TGTGCAGGACGGAGCTCAGGTGG - Intronic
1038852631 8:31295126-31295148 TGTGCTTCTAGCAACTCAGGAGG - Intergenic
1039084591 8:33767253-33767275 TGTGGTTCCAGCAACTCAGGAGG - Intergenic
1039956079 8:42208033-42208055 TGTGGTGGCGGGAGCTCAGGGGG + Intergenic
1042052113 8:64722285-64722307 TGTGCTTCCCAGACCTTATGTGG + Intronic
1042367881 8:67957398-67957420 TGTGCTCCCTGGAGCTCCAGAGG + Intronic
1042847934 8:73186896-73186918 TGGGCTCCCAGGAGCTCAGGAGG + Intergenic
1044983848 8:97741036-97741058 TGTGGTCCCAGGATCTCAGGAGG - Intergenic
1045266052 8:100619511-100619533 TGTGCTTCCCTGAACTCTGATGG - Intronic
1045460672 8:102422749-102422771 TGTGGTTCCAGCTGCTCAGGAGG + Intergenic
1045502371 8:102753465-102753487 TGTCCTGCCAGGAGTTCAGGAGG + Intergenic
1047443148 8:124896981-124897003 TGTGCTTCCTGGAACTCCAGGGG + Intergenic
1048342939 8:133554846-133554868 TGTAATTCCAGGTGCTCAGGAGG - Intronic
1048723655 8:137357521-137357543 TGTACTTCCAGGATTTCAGGAGG + Intergenic
1049232279 8:141490600-141490622 TGAGCCGCCAGGAGCTCAGGAGG - Intergenic
1051927301 9:22344613-22344635 TGTTCTTCCTGGAACTCATGAGG + Intergenic
1053051414 9:34964091-34964113 TGTGTTTCACTGAGATCAGGAGG - Intronic
1053066255 9:35071794-35071816 TGAGCTTCCCTGAGCTCGGCGGG + Intronic
1053228866 9:36387808-36387830 TGTGCTTCCCGGTGCACATTTGG - Intronic
1056512925 9:87322588-87322610 TGTGGTTCCAGGTACTCAGGAGG - Intergenic
1058463754 9:105208149-105208171 TGCCCTTCCCAGAGCTAAGGGGG - Intergenic
1059218087 9:112585516-112585538 TGTCCTCCACGGGGCTCAGGGGG + Intronic
1059407937 9:114113439-114113461 CGTGCTTCCCGCTGCTCCGGAGG - Intergenic
1060344683 9:122805890-122805912 TGAGCTGACAGGAGCTCAGGTGG - Intronic
1060470825 9:123946807-123946829 TGTAGTCCCCGTAGCTCAGGAGG + Intergenic
1061130029 9:128703386-128703408 AGTCCTTCCCGGAGCACAGGAGG + Intronic
1061437058 9:130570598-130570620 TGTGCTTCCAGCTACTCAGGAGG + Intergenic
1061512309 9:131068741-131068763 TGTGCTTTCCAGAGCACAGCTGG + Intronic
1061669591 9:132181203-132181225 TGTGATCCCAGGTGCTCAGGAGG - Intronic
1061908995 9:133712971-133712993 TGTCATTCCCAGAGCTCTGGGGG - Intronic
1061939227 9:133875177-133875199 TGTGCAAGCCGGGGCTCAGGAGG + Intronic
1061984852 9:134124684-134124706 TGTGCTTCCAGCTACTCAGGAGG + Intergenic
1062036476 9:134384800-134384822 TGGGTTTCCCTGTGCTCAGGCGG + Intronic
1062085728 9:134647115-134647137 TGTGCTTCTGGGAGCTAAAGAGG - Intronic
1062291474 9:135797179-135797201 TGGGCTCCTCGGAGGTCAGGAGG - Intergenic
1185473802 X:401141-401163 TGTGGTCCCTGGTGCTCAGGAGG - Intergenic
1185887753 X:3797872-3797894 TGTGGTCCCAGGAACTCAGGAGG - Intergenic
1187919449 X:24186499-24186521 TGTGGTTCCAGCTGCTCAGGAGG + Intronic
1188253559 X:27930249-27930271 TGTGTTTCTCGCAGCTCTGGAGG + Intergenic
1190305726 X:49080345-49080367 TTGGCTTCCCGGAGCCAAGGAGG - Intronic
1191846517 X:65551327-65551349 TGTGCTTCCAGGAGCTGTCGTGG - Intergenic
1192452185 X:71251503-71251525 TGTCCTTCCCAGAGCTAAGGGGG + Intronic
1194009822 X:88547842-88547864 TGTAGTTCCAGAAGCTCAGGAGG - Intergenic
1197741265 X:129896103-129896125 TGTGGTTCCAGGTACTCAGGAGG + Intergenic
1200209278 X:154339261-154339283 TGTGGTCCCAGCAGCTCAGGAGG + Intergenic
1200221598 X:154392868-154392890 TGTGGTCCCAGCAGCTCAGGAGG - Intronic