ID: 968636538

View in Genome Browser
Species Human (GRCh38)
Location 4:1683979-1684001
Sequence GCGCCACCGAACCACGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968636524_968636538 16 Left 968636524 4:1683940-1683962 CCCCAAGGCCCCGTTTACCACGG 0: 1
1: 0
2: 0
3: 1
4: 48
Right 968636538 4:1683979-1684001 GCGCCACCGAACCACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 41
968636521_968636538 29 Left 968636521 4:1683927-1683949 CCCCTTCGGGACGCCCCAAGGCC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 968636538 4:1683979-1684001 GCGCCACCGAACCACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 41
968636531_968636538 -1 Left 968636531 4:1683957-1683979 CCACGGCGACTCCCCGCCTCTCG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 968636538 4:1683979-1684001 GCGCCACCGAACCACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 41
968636523_968636538 27 Left 968636523 4:1683929-1683951 CCTTCGGGACGCCCCAAGGCCCC 0: 1
1: 0
2: 1
3: 15
4: 149
Right 968636538 4:1683979-1684001 GCGCCACCGAACCACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 41
968636530_968636538 6 Left 968636530 4:1683950-1683972 CCGTTTACCACGGCGACTCCCCG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 968636538 4:1683979-1684001 GCGCCACCGAACCACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 41
968636529_968636538 7 Left 968636529 4:1683949-1683971 CCCGTTTACCACGGCGACTCCCC 0: 1
1: 0
2: 0
3: 2
4: 70
Right 968636538 4:1683979-1684001 GCGCCACCGAACCACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 41
968636526_968636538 15 Left 968636526 4:1683941-1683963 CCCAAGGCCCCGTTTACCACGGC 0: 1
1: 0
2: 0
3: 2
4: 27
Right 968636538 4:1683979-1684001 GCGCCACCGAACCACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 41
968636528_968636538 8 Left 968636528 4:1683948-1683970 CCCCGTTTACCACGGCGACTCCC 0: 1
1: 0
2: 0
3: 5
4: 28
Right 968636538 4:1683979-1684001 GCGCCACCGAACCACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 41
968636527_968636538 14 Left 968636527 4:1683942-1683964 CCAAGGCCCCGTTTACCACGGCG 0: 1
1: 0
2: 0
3: 1
4: 26
Right 968636538 4:1683979-1684001 GCGCCACCGAACCACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 41
968636522_968636538 28 Left 968636522 4:1683928-1683950 CCCTTCGGGACGCCCCAAGGCCC 0: 1
1: 0
2: 0
3: 4
4: 59
Right 968636538 4:1683979-1684001 GCGCCACCGAACCACGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968636538 Original CRISPR GCGCCACCGAACCACGGCGC GGG Intronic
902916858 1:19644615-19644637 GCGCCTCCGGACGCCGGCGCTGG + Intronic
924676818 1:246187137-246187159 GCGCCACCGCACCAAAGTGCTGG - Intronic
1068139465 10:52986968-52986990 GCGCCACTGCACCACAGCCCAGG + Intergenic
1073336724 10:102715073-102715095 GCGCCACCGCACTCCGGCCCGGG - Intronic
1103883650 12:124185417-124185439 GCCCCACCGAGCCAAGGTGCTGG + Intronic
1202899537 14_GL000194v1_random:27382-27404 GCCCCACCTCTCCACGGCGCGGG + Intergenic
1125594207 15:40873944-40873966 GCGCTACCGGCCCACTGCGCTGG - Exonic
1129450274 15:75647668-75647690 GCGCCAGCGAGCGAGGGCGCTGG + Intronic
1132589655 16:721112-721134 GCGCCACGGACCGACCGCGCAGG + Exonic
1135094688 16:19555450-19555472 GCTCCTCCGAAGCATGGCGCCGG + Exonic
1139751167 16:69109638-69109660 GTGCCACCGAGCCCCGCCGCGGG - Exonic
1141723029 16:85767445-85767467 GCTCCGTGGAACCACGGCGCAGG + Intergenic
1146187236 17:30731889-30731911 GCGCCTCAGAAGCACGGCGGTGG + Intergenic
1146332278 17:31937250-31937272 GCGCCTCAGAAGCACGGCGGTGG + Exonic
1148641755 17:49192999-49193021 GCGCGACAGAACCAAGGGGCGGG + Intergenic
1160826368 19:1082284-1082306 GCCCCACCGAGCCCCGGCCCCGG - Intronic
1163417482 19:17195347-17195369 CCGCCACAGTTCCACGGCGCTGG - Exonic
1163559017 19:18008147-18008169 GCGGCGCCGACGCACGGCGCGGG + Exonic
1164834968 19:31350439-31350461 GCGCCCCCCATCCACGGCGCGGG + Intergenic
928313794 2:30231342-30231364 GCCGCAGCGAACCACGGCCCCGG + Intergenic
928956581 2:36875697-36875719 GCGCCACCGCACTCCAGCGCGGG - Intronic
940843185 2:158608854-158608876 GCGCCACCGAACTTCGGCTATGG - Intronic
943145666 2:184041567-184041589 GCGCCACTGAACTACAGCGTGGG + Intergenic
1171371693 20:24666331-24666353 GCGCCTCCCAATCACCGCGCTGG + Exonic
1172363229 20:34329481-34329503 GCGCCACCGCACTCCGGCCCAGG + Intergenic
1173874961 20:46364427-46364449 CCGCCGCCGAACCGCGGCACGGG + Exonic
1176552680 21:8235745-8235767 GCGCCACTGCACTACGGCCCAGG + Intergenic
1176571578 21:8418148-8418170 GCGCCACTGCACTACGGCCCAGG + Intergenic
1176579490 21:8462711-8462733 GCGCCACTGCACTACGGCCCAGG + Intergenic
1176618913 21:9042154-9042176 GCCCCACCTCTCCACGGCGCGGG + Intergenic
1184695568 22:46137130-46137152 GCTCCATCGAGCCACGGTGCAGG - Intergenic
1203257659 22_KI270733v1_random:152147-152169 GCGCCACTGCACTACGGCCCAGG + Intergenic
968636538 4:1683979-1684001 GCGCCACCGAACCACGGCGCGGG + Intronic
989638193 5:43557439-43557461 GCGCCAGCGAACCCTGGCGCAGG - Intronic
1006301016 6:33193479-33193501 GCCCCACGGAACCTCGGCGGCGG + Intergenic
1016597027 6:145814609-145814631 GCGCGGCCGAACCGCGGCCCAGG + Exonic
1022528241 7:31052102-31052124 GCGCCCCCGACCCCCGCCGCTGG + Intergenic
1022537178 7:31105462-31105484 GAGCCCCCGAACCACAGCTCTGG - Intronic
1035770843 8:2145614-2145636 GCCCCTCCGACCCACGGGGCTGG + Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1049172515 8:141170607-141170629 GCGTCCCCGAAGCACGGCACAGG - Intronic
1054350746 9:64015634-64015656 GCCCCACCTCTCCACGGCGCGGG + Intergenic
1057269967 9:93645177-93645199 GGGCCACCGAATCACAGCTCAGG - Intronic
1203473851 Un_GL000220v1:134169-134191 GCGCCACTGCACTACGGCCCAGG + Intergenic