ID: 968638926

View in Genome Browser
Species Human (GRCh38)
Location 4:1700171-1700193
Sequence ATGCAATCCAGAAGCTCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968638916_968638926 24 Left 968638916 4:1700124-1700146 CCAGGTCTGAGGAAGCTCCACCC 0: 1
1: 0
2: 1
3: 16
4: 207
Right 968638926 4:1700171-1700193 ATGCAATCCAGAAGCTCCGTGGG 0: 1
1: 1
2: 0
3: 5
4: 70
968638921_968638926 -4 Left 968638921 4:1700152-1700174 CCCGCAGGCACACCATCCTATGC 0: 1
1: 0
2: 0
3: 5
4: 133
Right 968638926 4:1700171-1700193 ATGCAATCCAGAAGCTCCGTGGG 0: 1
1: 1
2: 0
3: 5
4: 70
968638919_968638926 4 Left 968638919 4:1700144-1700166 CCCTGATGCCCGCAGGCACACCA 0: 1
1: 0
2: 0
3: 5
4: 158
Right 968638926 4:1700171-1700193 ATGCAATCCAGAAGCTCCGTGGG 0: 1
1: 1
2: 0
3: 5
4: 70
968638922_968638926 -5 Left 968638922 4:1700153-1700175 CCGCAGGCACACCATCCTATGCA 0: 1
1: 0
2: 2
3: 13
4: 176
Right 968638926 4:1700171-1700193 ATGCAATCCAGAAGCTCCGTGGG 0: 1
1: 1
2: 0
3: 5
4: 70
968638918_968638926 7 Left 968638918 4:1700141-1700163 CCACCCTGATGCCCGCAGGCACA 0: 1
1: 1
2: 0
3: 13
4: 195
Right 968638926 4:1700171-1700193 ATGCAATCCAGAAGCTCCGTGGG 0: 1
1: 1
2: 0
3: 5
4: 70
968638920_968638926 3 Left 968638920 4:1700145-1700167 CCTGATGCCCGCAGGCACACCAT 0: 1
1: 0
2: 0
3: 6
4: 64
Right 968638926 4:1700171-1700193 ATGCAATCCAGAAGCTCCGTGGG 0: 1
1: 1
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968638926 Original CRISPR ATGCAATCCAGAAGCTCCGT GGG Intronic
902417010 1:16245853-16245875 ACGCAGTCCCGAAGCTCCGAAGG - Intergenic
910292052 1:85608693-85608715 ATGCATTCTGGAAGCTCCATTGG - Intergenic
910341630 1:86194881-86194903 ATGAAATACAGACGCTCCCTTGG + Intergenic
911036036 1:93549301-93549323 ATGCAAACCAGGAAGTCCGTGGG + Exonic
912174540 1:107140448-107140470 CCGCAATCCAGAAGCGTCGTGGG + Intronic
914234463 1:145795595-145795617 ACCCAATCCAGAAGCTCAGCGGG + Intronic
918746148 1:188202814-188202836 ATGAATTCCAGAGGCTCTGTTGG - Intergenic
919796182 1:201322816-201322838 ATGCACTGCAGCAGCTCCATGGG - Intronic
924362698 1:243257438-243257460 AACTAATCCAGAAGCTCCATGGG - Intronic
1065356545 10:24847120-24847142 TTGCAATCGTGAAGCTCCTTTGG - Intergenic
1074142797 10:110689856-110689878 ATGCAATCCAGAATCTTCCCTGG - Intronic
1080210556 11:29780602-29780624 ATGCAAGCCAGATGCACCCTGGG - Intergenic
1083468280 11:62863942-62863964 ATGCAATCCAGCAGATCCTGGGG - Intronic
1083641556 11:64148397-64148419 ACAAAATCCAGAAGCTCCGGCGG + Intronic
1093161734 12:15754873-15754895 ATGCAATCATTAAGCTCCCTGGG + Intronic
1097396299 12:59079084-59079106 ATGCACCCCAGAAACTCCCTGGG - Intergenic
1112254663 13:97818715-97818737 AGGCATGCCAGAAGCTCCCTAGG - Intergenic
1113219779 13:108086819-108086841 TGGCAGTCCAGGAGCTCCGTGGG + Intergenic
1113405375 13:110033978-110034000 ATGCAATCCAGCATCTAAGTAGG + Intergenic
1120652075 14:87146618-87146640 ATGAAAGCCAGAAACTCAGTAGG + Intergenic
1121484819 14:94306425-94306447 GTGCAATTCAGAGGCCCCGTGGG - Intronic
1121937654 14:98035045-98035067 ATGCTATCCAGAAGCTTCTGGGG + Intergenic
1128126753 15:65198567-65198589 ATGAAATCAAGATGCTTCGTCGG - Exonic
1128467510 15:67925252-67925274 TTGCCATCCAGAAGCTCTCTGGG - Intergenic
1128713078 15:69886482-69886504 AGTCAATCCAGAAGATCTGTCGG - Intergenic
1130354900 15:83120288-83120310 GTGCAATGCAGAAGCTCCTGTGG - Intronic
1141964363 16:87431875-87431897 ATGAGACCCAGAAACTCCGTGGG + Intronic
1145010862 17:19366900-19366922 ATGCAAACCAGAAGCTACAGGGG + Intronic
1147446277 17:40477134-40477156 CTGCAAGCCAGGAGCCCCGTGGG + Exonic
1150385728 17:64758188-64758210 ATGAAATCCAGAAAATCAGTAGG - Intergenic
1156381270 18:36563643-36563665 ATGCAAACCAGCTTCTCCGTGGG + Intronic
1157793606 18:50555971-50555993 ATGAAATCCAGAAGCGTCCTGGG + Intergenic
1159367162 18:67483400-67483422 CTGCAAGCCTGAAGCTCAGTGGG + Intergenic
925795609 2:7539258-7539280 CTGCAACCCAGTAGCTCCATTGG - Intergenic
928060289 2:28105457-28105479 CTGCAATCCAGTAGCTCCCTAGG - Intronic
934578684 2:95420464-95420486 ATGCAATCCAGAAGCCCAGGGGG - Intergenic
934600759 2:95656245-95656267 ATGCAATCCAGAAGCCCAGGGGG + Intergenic
936534133 2:113298383-113298405 ATGCAATCCAGAAGCCCAGGGGG + Intergenic
943074245 2:183175341-183175363 TTGCTATCCAGAAGCTCTTTAGG + Intergenic
943855083 2:192779153-192779175 ACCCAACCCAGAAGCTCCGCTGG + Intergenic
1168830257 20:841682-841704 ATGCAAGCCAGAAGGGCCGGCGG + Intronic
1171102590 20:22399552-22399574 ATGCAATCCAGAATCTTGCTAGG + Intergenic
1171257064 20:23697457-23697479 AAGCAATCCAGGAGGTCTGTGGG - Intergenic
1171264423 20:23759312-23759334 AAGCAATCCAGGAGGTCTGTGGG - Intergenic
1171274220 20:23841962-23841984 AAGCAATCCAGGAGGTCTGTGGG - Intergenic
1172972604 20:38884330-38884352 ATGCAAGGCAGTAGCTCTGTAGG + Intronic
1177320489 21:19513678-19513700 CTGCCATCCAGAAGCTTCCTGGG - Intergenic
1182146771 22:28001525-28001547 ATGCACTCCAGCGGCCCCGTGGG - Exonic
1184347079 22:43920276-43920298 ATGCATTAGAGAAGCTCCTTAGG - Intergenic
959710677 3:109382969-109382991 ATGCAATTCAGAAGTTTCTTTGG + Intergenic
968638926 4:1700171-1700193 ATGCAATCCAGAAGCTCCGTGGG + Intronic
971066489 4:23038676-23038698 ATGCAATCCAGTCTCTCCGCAGG + Intergenic
977534263 4:98238554-98238576 ATCCAATCCAGAAGCTGCAGTGG + Intergenic
978495723 4:109357299-109357321 AGGCAATCCAGCACCTCCTTTGG + Intergenic
983031688 4:162810781-162810803 TTGCATTCCAGAAACTCCCTGGG - Intergenic
992063494 5:73081875-73081897 ATACAATCCAGAAGCTATGGTGG + Exonic
993272396 5:85812336-85812358 ATGCAATCCAGAAACACAGAAGG - Intergenic
993853768 5:93044998-93045020 ATTTAATCCAGAAGCCCTGTAGG - Intergenic
996019021 5:118571662-118571684 TTGCAATACATAAGCTCCTTGGG + Intergenic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
1010739502 6:79483347-79483369 ATGCAACCCAAAAGTTCCGTGGG + Intergenic
1016542041 6:145177563-145177585 ATGGAAACCAGAAGCTAAGTAGG + Intergenic
1017380372 6:153821396-153821418 ATCCAACCCAGAAGCTCAGCTGG - Intergenic
1021669578 7:23021752-23021774 ATGCAATCCAGAAGCTCCCTTGG + Intergenic
1024026360 7:45413208-45413230 ATGCCATGCACAAGGTCCGTGGG - Intergenic
1025579889 7:62699124-62699146 ATGCATTCCAGAATATCCCTTGG + Intergenic
1033629828 7:143146710-143146732 CTGCAATCCTGAAGCTTCTTAGG - Intergenic
1034740602 7:153470216-153470238 AAGCAATCCAGAAGATCCTCAGG + Intergenic
1045426921 8:102076657-102076679 ATTCAATCCAGAAGCCTCTTAGG - Intronic
1047498348 8:125424542-125424564 ATGCCATCCACAAGCTCCTCTGG - Intergenic
1047797820 8:128276144-128276166 ATGACATCAAGAATCTCCGTTGG + Intergenic
1049572341 8:143375158-143375180 ATGAAATCCAGAAGCGCAGAAGG + Intronic
1052082010 9:24218051-24218073 ATGAAATCCAGAAGTTCTTTTGG + Intergenic
1062191082 9:135248234-135248256 GTGCACTGCAGAAGCCCCGTGGG + Intergenic
1193145761 X:78074044-78074066 ATCCAACCCAGAAGCTCAGCTGG + Intronic
1195720078 X:107858843-107858865 ATCCATCCCAGAAGCTCCATGGG + Intronic
1199067521 X:143437581-143437603 ATGGATTCCAGAAGCACCTTCGG + Intergenic