ID: 968639593

View in Genome Browser
Species Human (GRCh38)
Location 4:1706158-1706180
Sequence ACCAGTAGGCCCCAGCTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1090
Summary {0: 1, 1: 0, 2: 65, 3: 274, 4: 750}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968639591_968639593 -5 Left 968639591 4:1706140-1706162 CCAGGTGCAGTGGTGCGCACCAG 0: 1
1: 13
2: 194
3: 1930
4: 16366
Right 968639593 4:1706158-1706180 ACCAGTAGGCCCCAGCTACTAGG 0: 1
1: 0
2: 65
3: 274
4: 750
968639588_968639593 23 Left 968639588 4:1706112-1706134 CCATCTCTAATAAAAATACAAAA 0: 2146
1: 205396
2: 140581
3: 64923
4: 140795
Right 968639593 4:1706158-1706180 ACCAGTAGGCCCCAGCTACTAGG 0: 1
1: 0
2: 65
3: 274
4: 750
968639586_968639593 25 Left 968639586 4:1706110-1706132 CCCCATCTCTAATAAAAATACAA 0: 995
1: 87918
2: 176366
3: 173708
4: 110257
Right 968639593 4:1706158-1706180 ACCAGTAGGCCCCAGCTACTAGG 0: 1
1: 0
2: 65
3: 274
4: 750
968639587_968639593 24 Left 968639587 4:1706111-1706133 CCCATCTCTAATAAAAATACAAA 0: 1029
1: 93794
2: 247256
3: 153685
4: 83477
Right 968639593 4:1706158-1706180 ACCAGTAGGCCCCAGCTACTAGG 0: 1
1: 0
2: 65
3: 274
4: 750

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968639593 Original CRISPR ACCAGTAGGCCCCAGCTACT AGG Intronic
900247511 1:1644319-1644341 GCCTGTAGGTCCCAGCTACGCGG + Intronic
900258735 1:1711456-1711478 GCCTGTAGGTCCCAGCTACGCGG + Intronic
900271581 1:1792570-1792592 ACCTGTAGTTCCCAGCTACTCGG + Intronic
900346209 1:2211570-2211592 GCCTGTAGTCCCAAGCTACTGGG - Intronic
900359288 1:2280248-2280270 GCCTGTAGTCCCCAGCTACTTGG + Intronic
901361891 1:8708450-8708472 ACCTGTAGTCCCCAGCTACTTGG - Intronic
901443047 1:9291309-9291331 ATCTGTAAGTCCCAGCTACTTGG - Intergenic
901519935 1:9775743-9775765 ATAAGTAGGCCCCGTCTACTTGG - Intronic
901956652 1:12790513-12790535 ACCTGTAATTCCCAGCTACTTGG + Intergenic
901980037 1:13026657-13026679 ACCCGTAATTCCCAGCTACTTGG + Intronic
902002049 1:13202274-13202296 ACCCGTAATTCCCAGCTACTTGG - Intergenic
902021273 1:13347999-13348021 ACCCGTAATTCCCAGCTACTTGG - Intergenic
902423187 1:16298098-16298120 ACCTGTAACTCCCAGCTACTGGG + Intronic
902430518 1:16359507-16359529 ACCTGTAAATCCCAGCTACTTGG - Intronic
902464942 1:16611352-16611374 CCCTGTAGGTCCCAGCTACTTGG + Intronic
903114375 1:21166599-21166621 ACCTGTAATCCCCAGCTACTCGG + Intronic
903155860 1:21442338-21442360 CCCTGTAGGTCCCAGCTACTTGG - Intronic
903374204 1:22855504-22855526 CCCAGTAGGTGCCAGGTACTGGG - Intronic
903545435 1:24120929-24120951 TCCAGCAGGCCCCAGGGACTTGG + Exonic
903990969 1:27269214-27269236 GCCTATAGTCCCCAGCTACTTGG + Intronic
904335682 1:29796189-29796211 ACCACTTGGCCCCTGCTACCTGG - Intergenic
904578663 1:31523491-31523513 ACCTGTAGTCCCCAGCTACTTGG - Intergenic
904732214 1:32602674-32602696 GCCTGTAAGTCCCAGCTACTCGG - Exonic
904739939 1:32666479-32666501 GCCTGTAGTCCCCAGCTACTGGG - Intronic
905152549 1:35943126-35943148 ACCTGTAGCCACCAGCTACTTGG - Intronic
905178271 1:36151483-36151505 ACCTCTGGCCCCCAGCTACTAGG + Intronic
905643275 1:39606910-39606932 ACCTGTAATACCCAGCTACTCGG + Intergenic
905669301 1:39780768-39780790 ACCTGTACTTCCCAGCTACTTGG + Intronic
905914884 1:41677944-41677966 ACCTGGAGGCCCCAGCTAATGGG + Intronic
906193151 1:43911811-43911833 ACCTGTAGCCCCCAGCTACTTGG - Intronic
906379643 1:45324314-45324336 GCCTGTAAGTCCCAGCTACTTGG + Intergenic
906379719 1:45324864-45324886 ACCTGTAGTCCCAAGCTACTTGG + Intergenic
906411975 1:45585773-45585795 ACCTGTAGTCCCAAGCTACTAGG - Intronic
906496958 1:46311450-46311472 GCCTGTAGCCCCCAGCTACTCGG + Intronic
907175091 1:52513274-52513296 GCCTGTAGTCCCAAGCTACTCGG + Intronic
907195376 1:52682171-52682193 ACATGTAGTCCCTAGCTACTTGG + Intergenic
907205053 1:52762704-52762726 ACCTGTAACTCCCAGCTACTTGG - Intronic
907287767 1:53392973-53392995 GCCTGTAGTTCCCAGCTACTCGG + Intergenic
907686729 1:56619123-56619145 GCCTGTATGTCCCAGCTACTTGG - Intronic
907816204 1:57920436-57920458 ACCTGTACTCACCAGCTACTTGG - Intronic
909144883 1:71917651-71917673 GCCTGTAGTCGCCAGCTACTCGG + Intronic
909429397 1:75569364-75569386 ACCTGTAGTCCCAAGCTACTTGG - Intronic
910400314 1:86831502-86831524 ACCTGTAGTCCCCAGCTACTTGG + Intergenic
910473116 1:87576785-87576807 ACCTGTAAGTCCCAGCCACTCGG - Intergenic
910483256 1:87682010-87682032 ACTAGTAGCCACTAGCTACTTGG + Intergenic
911512400 1:98823936-98823958 ACCTGTAAGTCCCAGCTACTCGG - Intergenic
911512580 1:98826012-98826034 GCCTGTAAGCCCTAGCTACTTGG + Intergenic
911573040 1:99540662-99540684 ACCAGGAGTCCCCAACTCCTGGG - Intergenic
911606493 1:99911566-99911588 GCCTGTAGTCCCCAGGTACTTGG - Intronic
911727211 1:101255137-101255159 CCCACTAAGCCCCAGCTACCTGG - Intergenic
912344789 1:108954368-108954390 ACCTGTAAATCCCAGCTACTTGG + Intronic
912350210 1:109005285-109005307 GCCTGTGGTCCCCAGCTACTTGG + Intronic
912867397 1:113270140-113270162 GCCTGTAATCCCCAGCTACTCGG - Intergenic
912888014 1:113497130-113497152 GCCTGTAAGTCCCAGCTACTTGG + Intronic
912995894 1:114532144-114532166 GCCTGTAATCCCCAGCTACTTGG - Intergenic
913206767 1:116546048-116546070 ACCTGTGGTCCCCAGCTACTTGG + Intronic
913244263 1:116857856-116857878 GCCTGTAGTCCCCAGGTACTTGG - Intergenic
913308824 1:117464231-117464253 GCCTGTACTCCCCAGCTACTTGG + Intronic
913600515 1:120417272-120417294 ACCTGTAGGTCCCAGCTACCTGG - Intergenic
913712304 1:121497272-121497294 GCCTGTAGTCCCCAGCTACTCGG + Intergenic
914086540 1:144459364-144459386 ACCTGTAGGTCCCAGCTACTTGG + Intronic
914192436 1:145423312-145423334 ACCTGTAGGTCCCAGCTACCTGG + Intergenic
914266253 1:146040703-146040725 GCCTGTAATCCCCAGCTACTCGG - Intergenic
914311789 1:146473004-146473026 CGCTGTAGGTCCCAGCTACTTGG - Intergenic
914345122 1:146792406-146792428 GCCTGTAGTCCCAAGCTACTTGG + Intergenic
914361679 1:146941207-146941229 TCCTGTAGGTCCCAGCTACTTGG - Intronic
914489945 1:148145752-148145774 TCCTGTAGGTCCCAGCTACTTGG + Intronic
914590345 1:149101260-149101282 ACCTGTAGGTCCCAGCTACTTGG + Intronic
914810062 1:151021019-151021041 GCCTGTAAGTCCCAGCTACTTGG + Intronic
915156143 1:153878068-153878090 AAAAGTAGGCTCCAGCTCCTTGG + Intronic
915157639 1:153891442-153891464 ACCTGTAAATCCCAGCTACTTGG + Intronic
915198538 1:154208870-154208892 ACCTGCAATCCCCAGCTACTCGG - Intronic
915394514 1:155572585-155572607 ACCTGTAATCCCAAGCTACTCGG + Intergenic
915576353 1:156780851-156780873 GCCTGTAATCCCCAGCTACTCGG - Intronic
915961173 1:160268039-160268061 ACCTGTAAGTCCCAGCTACTTGG + Intergenic
916091609 1:161311822-161311844 GCCTGTAGTTCCCAGCTACTTGG - Intergenic
917157544 1:172020596-172020618 GCCTGTAGTTCCCAGCTACTCGG + Intronic
917167368 1:172127532-172127554 GCCTGTAGTCCCAAGCTACTTGG - Intronic
917334734 1:173915549-173915571 ACCTGTAGTCCCAAGCTACTAGG + Intronic
917571890 1:176275233-176275255 ACCTGTAGTCCCCAGATACTTGG + Intergenic
917982994 1:180284487-180284509 GCCTGTAAGTCCCAGCTACTTGG - Intronic
918263204 1:182815727-182815749 GCCTGTAAGTCCCAGCTACTTGG - Intronic
919039973 1:192373519-192373541 ACCTTTAGGTCCCAGCTACTTGG - Intergenic
919230814 1:194771655-194771677 ACCTGTAGGTCCCAGCTACTCGG - Intergenic
919449912 1:197759093-197759115 ACCTGTAGTCCCCAGCTATTTGG - Intronic
919866199 1:201784891-201784913 GCCTGTAGTCCCCAGCTACTCGG - Intronic
920001184 1:202800167-202800189 ACCTGTAGTCCCAAGCTACTCGG - Intronic
920186954 1:204165714-204165736 ACTTGTAATCCCCAGCTACTCGG - Intronic
920314507 1:205067800-205067822 ACCTGTAAATCCCAGCTACTCGG + Intronic
920382315 1:205542360-205542382 GCCTGTAAGTCCCAGCTACTTGG - Intergenic
920634641 1:207688148-207688170 GCCTGTAAGTCCCAGCTACTTGG + Intronic
920766322 1:208837089-208837111 TCCAGTAGGCCCCAGATATCTGG + Intergenic
921003185 1:211065931-211065953 ACCTGTAGTCCCCACCTACTTGG + Intronic
922247988 1:223819056-223819078 GCCTGTAATCCCCAGCTACTCGG + Intronic
922301640 1:224306705-224306727 ACCTGTAGTCCCCAGCTACTTGG + Intronic
922321447 1:224491729-224491751 ACCTGTAGTTCCCTGCTACTTGG - Intronic
922780466 1:228248743-228248765 ACCTGTAAGTCCCTGCTACTTGG + Intronic
923162773 1:231330912-231330934 ACCTGTAAGTCCCAGCTACTCGG - Intergenic
923587291 1:235285036-235285058 ACCTGTAGGTCCCAGCTACTTGG - Intronic
923594240 1:235348355-235348377 GCCTGTAGTCTCCAGCTACTTGG - Intergenic
923635432 1:235691820-235691842 ACCTGTAAATCCCAGCTACTCGG - Intronic
923893112 1:238237449-238237471 ACCTGTAATCCCCAGCTACTCGG + Intergenic
924245470 1:242079617-242079639 ACCTGTAAATCCCAGCTACTTGG - Intergenic
924549693 1:245063845-245063867 GCCTGTAACCCCCAGCTACTCGG - Intronic
924615963 1:245612233-245612255 GCCTGTAGTCCCAAGCTACTTGG - Intronic
924811983 1:247410852-247410874 ACCTGTGGTCCCCAGCTACTGGG - Intergenic
1062873135 10:924116-924138 ACCCATGGGTCCCAGCTACTCGG + Intronic
1063419945 10:5904154-5904176 GCCTGTAAGTCCCAGCTACTTGG - Intronic
1063454432 10:6173298-6173320 ACCTGTAGTCCTCAGCTGCTGGG + Intronic
1063794893 10:9502807-9502829 ATCAGTGGTCCCCAGCTAGTGGG - Intergenic
1063959820 10:11297854-11297876 ACCTGTGGTTCCCAGCTACTCGG + Intronic
1064124650 10:12649451-12649473 TGCAGAAGGCACCAGCTACTTGG - Intronic
1064296075 10:14080168-14080190 ACAAAGATGCCCCAGCTACTGGG + Intronic
1064325535 10:14347685-14347707 CACAGTTGGTCCCAGCTACTTGG + Intronic
1064340716 10:14483048-14483070 ACCTGTTAGTCCCAGCTACTTGG - Intergenic
1064908773 10:20377461-20377483 ACCTGTAGTTCCCAGCTGCTTGG + Intergenic
1065071747 10:22032070-22032092 GCCTGTAGTTCCCAGCTACTGGG + Intergenic
1065172741 10:23048384-23048406 GCCTGTAAGTCCCAGCTACTCGG + Intergenic
1065303492 10:24346694-24346716 ACCTGGTGGTCCCAGCTACTTGG - Intronic
1065627776 10:27649226-27649248 ACCAGATAGTCCCAGCTACTCGG - Intergenic
1065952842 10:30667594-30667616 GCAGGTAGTCCCCAGCTACTTGG - Intergenic
1066081863 10:31938606-31938628 ACCTGTAGTTCCCAGCTACTTGG - Intergenic
1066352236 10:34646799-34646821 ACCTGTGGGTCCCAGCTGCTTGG - Intronic
1066373494 10:34837122-34837144 GCCTGTAAGTCCCAGCTACTCGG - Intergenic
1066409902 10:35157508-35157530 ACCTGTAAGTCCCAGCTACTTGG + Intronic
1066423667 10:35285139-35285161 ACCTGTAGTCCCCAGCTACTCGG - Intronic
1066587195 10:36948940-36948962 AGCAGTAAACCCAAGCTACTGGG - Intergenic
1067007338 10:42677323-42677345 ACCTGTAAGTCCCAGCTACTTGG + Intergenic
1067357353 10:45542219-45542241 ACCTGTAGTCCCCAGCTACTTGG + Intronic
1068079564 10:52303165-52303187 ACCTGTAAGTCCCAGCTACTTGG - Intergenic
1068175968 10:53458808-53458830 ACCTGTAAGTCCCAGCTACTCGG + Intergenic
1069006016 10:63318129-63318151 ACCTGTAATTCCCAGCTACTTGG - Intronic
1069597090 10:69679141-69679163 ACCTGTAAATCCCAGCTACTCGG + Intergenic
1069671372 10:70207542-70207564 GCCTGTAGTACCCAGCTACTTGG + Intronic
1069732232 10:70624675-70624697 ACCTGTAGTTCCCAGCTACTCGG - Intergenic
1070097850 10:73355650-73355672 GCCTGTAAGTCCCAGCTACTTGG + Intronic
1070214988 10:74368753-74368775 GCCTGTAAGTCCCAGCTACTTGG - Intronic
1070241535 10:74686800-74686822 ACCTGTAGTCGCCAGCTACTTGG - Intronic
1070278089 10:75027011-75027033 GCCTGTAAGTCCCAGCTACTTGG + Intronic
1070296209 10:75163557-75163579 GCCTGTAAGTCCCAGCTACTTGG - Intronic
1070467048 10:76733924-76733946 ACCATTAGGGCACAGCTAATGGG - Intergenic
1070944469 10:80377641-80377663 ACCTGCAGTCCTCAGCTACTTGG - Intergenic
1071138479 10:82479536-82479558 GCCTGTAATCCCCAGCTACTTGG + Intronic
1071322100 10:84472444-84472466 GCCTGTAGTCCCCAGCTACTTGG + Intronic
1071907961 10:90195981-90196003 ACCTGTAGTCCTCAGCTACTTGG + Intergenic
1071959522 10:90796584-90796606 GCCTGTAGGTCCCAGCTACTAGG + Intronic
1072120234 10:92399597-92399619 ACCTGTAGCCTCCAGCTACTCGG + Intergenic
1072238112 10:93470524-93470546 ACCTGTAGTCCCAAGCTACTTGG - Intronic
1072334302 10:94383997-94384019 GCCTGTAGTCCCAAGCTACTTGG - Intergenic
1072422593 10:95301669-95301691 ACCTGTAGGTCCCAGCTACTTGG - Intergenic
1072639420 10:97200242-97200264 GCCAGTAATCCCCAGCTACTCGG + Intronic
1073370217 10:102981513-102981535 ACCTGTGGGTCCCAGCTACTCGG - Intronic
1074368503 10:112879458-112879480 GCCTGTAGTCCCCAGCTACTTGG - Intergenic
1074598682 10:114891066-114891088 ACTTGAAGGCCCCAGCTACTGGG + Intronic
1074769460 10:116723901-116723923 ACCCGCTGGCCTCAGCTACTGGG - Intronic
1074782712 10:116813369-116813391 GCCTGTAGTCCCCAGCTACTTGG - Intergenic
1075371502 10:121939767-121939789 GCCTGTAATCCCCAGCTACTTGG + Intergenic
1075381867 10:122025697-122025719 TCCTGTAGCTCCCAGCTACTTGG - Intronic
1075757923 10:124830318-124830340 ACCTGTAGTCCTCAGCTACTTGG + Intronic
1076357738 10:129865234-129865256 ATCTGTAGGCCCCAGGTACCTGG - Intronic
1077067206 11:647327-647349 GCCTGTAATCCCCAGCTACTAGG + Intronic
1077884229 11:6374187-6374209 GCCTGTAATCCCCAGCTACTCGG + Intergenic
1078240401 11:9526014-9526036 GCCTGTAGTGCCCAGCTACTTGG + Intronic
1078277646 11:9865563-9865585 GCCTGTAATCCCCAGCTACTTGG + Intronic
1078755999 11:14210522-14210544 GCCTGTAAGTCCCAGCTACTCGG - Intronic
1078765497 11:14292980-14293002 GCCTGTAGTCCCAAGCTACTTGG + Intronic
1079016758 11:16875570-16875592 ACCTGTAAGTCCCAGCTAGTTGG - Intronic
1079202988 11:18391223-18391245 GCCTGTAATCCCCAGCTACTTGG - Intergenic
1079217320 11:18525418-18525440 ACCTGTAATCCCCAGCTACTTGG + Intronic
1079723719 11:23852010-23852032 ACCTGTAAATCCCAGCTACTCGG + Intergenic
1079936651 11:26625048-26625070 GCCTGTAGTCCCCAACTACTCGG - Intronic
1080468350 11:32519878-32519900 ACCTGTAGTTCCCAGCTACTAGG + Intergenic
1080534153 11:33205466-33205488 GCCTGTAAGTCCCAGCTACTTGG - Intergenic
1080841205 11:35985048-35985070 ACGAGTAGTTCCCTGCTACTTGG - Intronic
1081011439 11:37817794-37817816 GCCTGTAGTCCCCAACTACTCGG - Intergenic
1081098215 11:38967522-38967544 GCCTGTAGTTCCCAGCTACTCGG + Intergenic
1081281222 11:41211115-41211137 ACCAGGGGGCCCCAACTCCTGGG - Intronic
1081533960 11:43983989-43984011 ACCTGTAAGTCCCAGGTACTTGG + Intergenic
1081579479 11:44342354-44342376 AGCCTTTGGCCCCAGCTACTTGG - Intergenic
1082005510 11:47416835-47416857 ACCTGTAAATCCCAGCTACTTGG - Intergenic
1082113848 11:48306642-48306664 ACCAGGAGGCCCCCGCTAGCAGG - Exonic
1083402788 11:62435535-62435557 GCCTGTAGTCCCCAGCTACTCGG - Intronic
1083422732 11:62564336-62564358 ACCTGCAATCCCCAGCTACTCGG + Intronic
1083482746 11:62960176-62960198 ACCTGTAAATCCCAGCTACTTGG - Intronic
1083559321 11:63659809-63659831 ACCTGTAAGTCCTAGCTACTCGG + Intronic
1083604723 11:63971364-63971386 GCCTGTAGTCCCCAACTACTCGG + Intergenic
1083977391 11:66134389-66134411 ACCTGTAGGTCCCAGCTACTAGG - Intronic
1084631870 11:70357710-70357732 GCCTGTAAGTCCCAGCTACTCGG - Intronic
1084969772 11:72764755-72764777 ACCAGGAACCCCCAGCTATTAGG + Intronic
1085141491 11:74147289-74147311 ACCTGTTAGTCCCAGCTACTAGG + Intronic
1085364262 11:75924509-75924531 GCCTGTAAGTCCCAGCTACTTGG - Intronic
1087679636 11:101204997-101205019 GCCTGTAGTCCCCAGGTACTCGG - Intergenic
1087735285 11:101826168-101826190 ACCTGTAAGTCCCAGCTACCTGG + Intronic
1088137821 11:106578640-106578662 GCCTGTAATCCCCAGCTACTTGG - Intergenic
1088437947 11:109836129-109836151 ACCTGTAGTCCTCAGCTACTCGG - Intergenic
1088856328 11:113758045-113758067 ACCTGTAAATCCCAGCTACTCGG + Intronic
1089558223 11:119327729-119327751 GCCTGTAAGTCCCAGCTACTTGG - Intergenic
1090180084 11:124689650-124689672 ACCTGTAGTCCCCAGCTACTTGG + Intronic
1090886839 11:130884743-130884765 GCCTGTAGTCTCCAGCTACTCGG + Intronic
1091423773 12:367734-367756 ACCTGTAGTTCCCAGCTACCTGG + Intronic
1092181371 12:6449119-6449141 ACCTGTAGGCCCAAGCTACTGGG - Intronic
1092186823 12:6486430-6486452 ACCTGTAATCCCCAGTTACTTGG - Intergenic
1092198411 12:6564148-6564170 ACCTGTAAATCCCAGCTACTTGG + Exonic
1092201426 12:6586273-6586295 ACCTGTAGTCCCCAGCTACTCGG + Intronic
1092260113 12:6948817-6948839 ACCTGTGAGTCCCAGCTACTAGG + Intronic
1092460280 12:8680279-8680301 GCCTGTAGTCCCCAGCTACTCGG - Intergenic
1093147245 12:15581425-15581447 CTCAGAATGCCCCAGCTACTCGG - Intronic
1093634301 12:21446296-21446318 ACCTGTTAGTCCCAGCTACTCGG + Intronic
1093933100 12:24973888-24973910 GCCTGTAATCCCCAGCTACTCGG - Intergenic
1094660749 12:32468166-32468188 ACCTGTAGTTCCCAGCTACTTGG - Intronic
1095195148 12:39305507-39305529 ACCTATAAGTCCCAGCTACTGGG - Intronic
1095455056 12:42374563-42374585 GCCTGTAGTCCCCAGCTTCTTGG - Intronic
1095818876 12:46455121-46455143 ACCTGTAGTCCCCAGCTACTTGG - Intergenic
1096213481 12:49784832-49784854 ACGCCTAGGTCCCAGCTACTGGG + Intergenic
1096395131 12:51260314-51260336 ACCTGTAACTCCCAGCTACTTGG - Intronic
1096713198 12:53473207-53473229 GCCTGTAAGTCCCAGCTACTTGG - Intronic
1096926066 12:55147970-55147992 GCCTGTAGTCCCAAGCTACTTGG + Intergenic
1096987487 12:55770349-55770371 GCCTGTAAGTCCCAGCTACTCGG - Intronic
1097047259 12:56196354-56196376 GCCTGTAGTCCCCAGCTACTGGG - Intergenic
1097212769 12:57385365-57385387 GCCTGTAAGTCCCAGCTACTTGG - Intronic
1097215429 12:57407888-57407910 ACCTGTAGTCCCCAGCTATGTGG - Intronic
1097881395 12:64689911-64689933 GCCTGTAAGTCCCAGCTACTCGG - Intronic
1098170260 12:67739620-67739642 ACCTGTAAGTCCCAGTTACTCGG + Intergenic
1098279159 12:68845887-68845909 ACCTGTGGTCCCCAGCTACTTGG - Exonic
1098516195 12:71378764-71378786 ACCTGTAAGTCCCAGCTACTCGG + Intronic
1098561811 12:71881790-71881812 GCCTGTAAGTCCCAGCTACTGGG + Intronic
1098896228 12:76064041-76064063 ACCTGTGGCTCCCAGCTACTTGG + Intronic
1099962339 12:89408609-89408631 GCCTGTAGTCCCCAGCTACTTGG - Intergenic
1100422993 12:94455920-94455942 ACCTGTTAGCCCCAGCCACTTGG + Intronic
1100450193 12:94698526-94698548 GCCTGTAAGTCCCAGCTACTTGG + Intergenic
1100628008 12:96356419-96356441 ACCTGTAAGTCCCAGCGACTTGG - Intronic
1100830124 12:98510059-98510081 ACCTGTAATCCCCAGCTACTTGG - Intergenic
1100980099 12:100156924-100156946 GTCAGTAGCCCCAAGCTACTGGG + Intergenic
1101305448 12:103523176-103523198 ACCAGTAGGTCCCAGTCACTTGG + Intergenic
1101410604 12:104464630-104464652 ACCTGTAAGTCCCAGCTGCTTGG - Intronic
1102176323 12:110877829-110877851 ACCTGTAATCCCCAGCTACTTGG - Intronic
1102178070 12:110890900-110890922 GCCTGTAGTCCCCAGATACTCGG - Intronic
1102334690 12:112068162-112068184 GCCTGTAGTCCCCAGCTACTTGG - Intronic
1102362616 12:112301306-112301328 ACCTGTAAAGCCCAGCTACTAGG - Intronic
1102382958 12:112483311-112483333 ACCTGTAGCCCCCAGCTACATGG - Intronic
1102451329 12:113044124-113044146 GCCTGTAGGTCCCAGCTACTTGG + Intergenic
1102864474 12:116363039-116363061 GCCTGTAGTCCCCAGCTACTCGG + Intergenic
1102887367 12:116532293-116532315 ACCTGTAATCCCCAGCAACTGGG + Intergenic
1102966732 12:117133434-117133456 GCCTGTAATCCCCAGCTACTTGG - Intergenic
1103077893 12:117999636-117999658 CCCTGTAGTTCCCAGCTACTTGG - Intergenic
1103486202 12:121284448-121284470 GCCTGTAATCCCCAGCTACTTGG - Intronic
1103665813 12:122564591-122564613 ATCTGTAGTCCCAAGCTACTTGG - Intronic
1103766683 12:123285236-123285258 GCCTGTAAGTCCCAGCTACTCGG - Intergenic
1104023981 12:125012956-125012978 ACCTGTAGTCCCCATCCACTTGG + Intronic
1104995250 12:132650081-132650103 GCCTGTAGTCCCAAGCTACTTGG + Intronic
1105377373 13:19858069-19858091 GCCTGTAATCCCCAGCTACTTGG + Intronic
1105476399 13:20731338-20731360 ACCTGTAAGTTCCAGCTACTTGG + Intronic
1105491728 13:20894716-20894738 ACCTGTAAATCCCAGCTACTGGG + Intronic
1105496544 13:20935696-20935718 ACCTGTAGTCCCCAGCTACTGGG + Intergenic
1105926295 13:25011751-25011773 CCCTGTAGGTCCCAGCTACTTGG + Intergenic
1105972218 13:25439779-25439801 ACCTGTAGTCCCCAGCTACTTGG + Intronic
1106332573 13:28753138-28753160 ACCTGTAGTTTCCAGCTACTTGG + Intergenic
1106732546 13:32556456-32556478 GCCTGTAGTCCCCAGCTATTGGG - Intergenic
1106732698 13:32558176-32558198 ACCTGTAGTCCCCAGCTACTTGG + Intergenic
1106822548 13:33481855-33481877 GCCTGTAAGTCCCAGCTACTCGG + Intergenic
1107517391 13:41144284-41144306 ACCTGTAATCCCCAGCTACTTGG - Intergenic
1107536456 13:41339681-41339703 ACCTGTATTCCCAAGCTACTTGG - Intronic
1107604465 13:42043958-42043980 ACCTATAGGTCCCAGCTACTCGG - Intronic
1108102442 13:46970931-46970953 ACCTGTAGGTCCCAGTAACTTGG + Intergenic
1108187070 13:47898631-47898653 GCCTGTAGTCCCAAGCTACTCGG - Intergenic
1108380359 13:49848652-49848674 CCCATGTGGCCCCAGCTACTAGG + Intergenic
1108399294 13:50023004-50023026 GCCTGTAGTCCCCAGTTACTTGG + Intergenic
1108540040 13:51433320-51433342 GCCTGTAGTGCCCAGCTACTCGG + Intronic
1108621643 13:52190628-52190650 ACCTGTAATTCCCAGCTACTTGG + Intergenic
1110299389 13:73908274-73908296 GCCTGTAGTCCCAAGCTACTCGG + Intronic
1110583360 13:77158566-77158588 GCCTGTAAGTCCCAGCTACTTGG - Intronic
1112985158 13:105439643-105439665 ACCTGTAGTCCCCAGCTACTTGG + Intergenic
1113719559 13:112544325-112544347 ACCTGTAGTCCCAAGCTACCTGG + Intronic
1113865064 13:113516438-113516460 GCCTGTAATCCCCAGCTACTCGG + Intronic
1114290026 14:21280367-21280389 GCCTGTAGTCCCCAGCTACTTGG - Intergenic
1114292952 14:21303860-21303882 ACCTGTAAATCCCAGCTACTAGG + Intronic
1114321439 14:21550054-21550076 GCCTGTAATCCCCAGCTACTCGG - Intergenic
1115180574 14:30621540-30621562 CCCTGTAGTCCCTAGCTACTTGG + Intergenic
1115219016 14:31040947-31040969 GCCTGTAAGTCCCAGCTACTCGG + Intronic
1115601775 14:34962086-34962108 ACCAGTAAGTCCCGGCTACCTGG - Intergenic
1115621221 14:35142471-35142493 ACCTGTAAGTCCTAGCTACTTGG - Intronic
1115622010 14:35149977-35149999 GCCTGTAATCCCCAGCTACTCGG - Intronic
1115685879 14:35795856-35795878 ACCTGTAGTTCCCAGCTACTCGG + Intronic
1115824001 14:37244243-37244265 ACCTGTAGTCCCCAGCTACTCGG - Intronic
1115891420 14:38033663-38033685 GCCTGTAGTCCCCAGCTACTTGG + Intronic
1115949733 14:38707327-38707349 GCCTGTAGTCCCAAGCTACTTGG - Intergenic
1116253329 14:42516181-42516203 GCCTGTAAGTCCCAGCTACTCGG + Intergenic
1116359576 14:43976347-43976369 GCCTGTAAGTCCCAGCTACTTGG - Intergenic
1116838236 14:49792338-49792360 ACCTGTAGGTCCCAGCTTCTTGG - Intronic
1117117968 14:52535896-52535918 GCCTATAGGTCCCAGCTACTCGG + Intronic
1117395533 14:55305569-55305591 GTCTGTAGTCCCCAGCTACTCGG + Intronic
1117681178 14:58204423-58204445 ACCTGTAGTCCCCAGCTACTTGG + Intronic
1117923281 14:60748069-60748091 ACCTGTAGTCCCAAGCTACTTGG + Intronic
1118111081 14:62720455-62720477 ACCTGTAAGTCCCAGCTACTCGG + Intronic
1118549720 14:66937126-66937148 GCCTGTAGTCCCCAGCTACTTGG - Intronic
1118833997 14:69463093-69463115 ACCTGTAAATCCCAGCTACTCGG + Intergenic
1120462184 14:84811711-84811733 GCCTGTAGTCCCCAGCTATTAGG + Intergenic
1120597136 14:86454579-86454601 ACCTGTAAGTCCTAGCTACTTGG - Intergenic
1121296138 14:92826027-92826049 ACCTGTAAGTCCCAGCTACTTGG + Intronic
1121554031 14:94822843-94822865 ATCTGTAAGTCCCAGCTACTAGG - Intergenic
1121628008 14:95400759-95400781 GCCTGTAGTTCCCAGCTACTCGG + Intergenic
1122064064 14:99159547-99159569 GCCAGGAGGCCCCAGCTGCCTGG + Intergenic
1122623437 14:103072402-103072424 ACCTGTAGTTCCCAGCTACTCGG + Intergenic
1122706885 14:103627584-103627606 ACCTGTAGTCCCTAGCTACTTGG + Intronic
1122733845 14:103823211-103823233 GCCTGTAGGTCCCAGCTACTTGG + Intronic
1122912924 14:104842159-104842181 ACCCTTAGTCCCCAGCTATTTGG - Intergenic
1123401344 15:19990000-19990022 GCCTGTAGTCCCCAGGTACTCGG + Intergenic
1124110918 15:26785860-26785882 ACCTCTAAGTCCCAGCTACTAGG - Intronic
1124459815 15:29878996-29879018 GCCTGTAGTCCCCAGCTACTCGG + Intronic
1124561854 15:30781689-30781711 GCCTGTAATCCCCAGCTACTTGG - Intergenic
1125652040 15:41325278-41325300 CCCTGTAAGTCCCAGCTACTCGG + Intronic
1125707527 15:41752678-41752700 ACCTGTAATCCCAAGCTACTCGG - Intronic
1125777816 15:42233893-42233915 GCCTGTAGTCCTCAGCTACTCGG - Intronic
1125823790 15:42658268-42658290 ACCTGTAAGTCCCAGCTACTTGG - Intronic
1125934147 15:43620044-43620066 GCCTGTAGTCCTCAGCTACTTGG - Intergenic
1125985785 15:44050483-44050505 GCCTGTAGTCCCCAGCTACTCGG - Intronic
1126755726 15:51923258-51923280 GCCTGTAGTCCTCAGCTACTTGG + Intronic
1127505122 15:59590731-59590753 ACCTGTAAATCCCAGCTACTGGG + Intergenic
1127783663 15:62337787-62337809 ACCTGTAAGTCCCAGCTACTTGG + Intergenic
1127881250 15:63160127-63160149 ACCTGTAGACACCAGCTACTTGG + Intergenic
1128049349 15:64650017-64650039 GCCAGTAAGTCCCAACTACTTGG + Intronic
1128169344 15:65497013-65497035 ACCTGTAATTCCCAGCTACTAGG - Intronic
1128221084 15:65969176-65969198 ACCAGTAGACCCTAGCTCATTGG - Intronic
1128240070 15:66095783-66095805 ATCAGAAGGACCCAGGTACTAGG - Intronic
1128298338 15:66544455-66544477 ACCCATAGTCCCAAGCTACTTGG - Intronic
1128488646 15:68123175-68123197 ACCAGTAGGTCCTAGCTACTTGG - Intronic
1129147794 15:73664823-73664845 GCCTGCAGGTCCCAGCTACTCGG - Intergenic
1129292124 15:74576531-74576553 GCCTGTAGTCCCAAGCTACTTGG + Intronic
1129528573 15:76241674-76241696 CCCTGTAAGTCCCAGCTACTCGG + Intronic
1129565263 15:76615318-76615340 TCCTGTAGTCCCAAGCTACTTGG + Intronic
1129820355 15:78597303-78597325 GCCTGTAATCCCCAGCTACTTGG + Intronic
1130143558 15:81253985-81254007 ACAAGTAGGCCCCAGCAGATTGG - Intronic
1130444623 15:83989005-83989027 GCCTGTAGTCCCCAGCTACTCGG - Intronic
1130579923 15:85127069-85127091 TCCTGTAGTCCCAAGCTACTTGG + Intronic
1130581394 15:85140161-85140183 TCCTGGAGTCCCCAGCTACTCGG + Intergenic
1130646420 15:85731128-85731150 ATCTGTAGTCCCAAGCTACTTGG - Intronic
1131147243 15:90021954-90021976 GCCTGTAAGTCCCAGCTACTTGG + Intronic
1131230693 15:90656843-90656865 AACAGTAATTCCCAGCTACTCGG - Intergenic
1131491680 15:92868571-92868593 GCCTGTAAGTCCCAGCTACTCGG - Intergenic
1132078185 15:98840573-98840595 ACCTGTAGTCCCCAGCCACTTGG - Intronic
1132475338 16:133348-133370 GCCTGTAATCCCCAGCTACTCGG - Intronic
1132800912 16:1752621-1752643 ACCTGTAAGTCCCAGCTACTTGG + Intronic
1132811462 16:1800205-1800227 ACCTGTGAGTCCCAGCTACTTGG - Intronic
1132948294 16:2545160-2545182 ACCTGTAAGTCCCAGCTACTTGG - Intronic
1133160421 16:3908127-3908149 GCCTGTAAGTCCCAGCTACTTGG - Intergenic
1133176111 16:4015840-4015862 GCCTGTAAGTCCCAGCTACTCGG + Intronic
1133300092 16:4777139-4777161 GCCTGTAGTCCCCAGCTACCTGG + Intergenic
1133421296 16:5649292-5649314 GCCTGTAGTTCCCAGCTACTTGG - Intergenic
1133954563 16:10429976-10429998 ACCTGTAATCCCAAGCTACTCGG - Intronic
1134251309 16:12576002-12576024 GCCTGTAGGTCCCAGCTACCTGG - Intergenic
1134260494 16:12647470-12647492 ACCTGTAGTCCCCAGCTATTGGG - Intergenic
1134419845 16:14076315-14076337 ACCTGTAGTCCCAAGCTACTTGG - Intronic
1134611139 16:15609112-15609134 ACCTGTAATCCCCAGCTACTCGG + Intronic
1134870313 16:17646869-17646891 ACCTGTAATCCCAAGCTACTTGG + Intergenic
1135268710 16:21050562-21050584 GCCTGTAAGTCCCAGCTACTTGG - Intronic
1135336243 16:21603667-21603689 ACCCTTAGGCCCCAGGTTCTTGG + Intronic
1135654362 16:24234710-24234732 ACCTGTAAGTCCCAGCTACTTGG - Intergenic
1135744780 16:25007489-25007511 GCATGTAGTCCCCAGCTACTTGG - Intronic
1135760937 16:25137568-25137590 ACCTGTAGTCCCCAGCTACTTGG - Intronic
1135963247 16:27015237-27015259 ACCTGTAATTCCCAGCTACTTGG + Intergenic
1136153528 16:28367530-28367552 GCCTGTAATCCCCAGCTACTAGG + Intergenic
1136209558 16:28747737-28747759 GCCTGTAATCCCCAGCTACTAGG - Intergenic
1136241221 16:28945499-28945521 ACCTGTAAGTCCCAGCTACTAGG - Intergenic
1136503121 16:30684409-30684431 ACCTTTAGTCCCCAGCTACTTGG - Intergenic
1136526851 16:30836598-30836620 ACCTGTAAGTCCCAGCTACTTGG - Intronic
1137238459 16:46634226-46634248 GCCTGTAGGTCCCAGCTACTCGG + Intergenic
1137337919 16:47569744-47569766 ACCTGTAAGTCCCAGCTACTGGG - Intronic
1137355753 16:47761903-47761925 GCCTGTAGTCCCCAGCTACTTGG + Intergenic
1137412718 16:48243274-48243296 GCCTGTAGTCCCCAGCTACTCGG + Intronic
1137931730 16:52594849-52594871 ACCAGTAGGCACCAGATGGTTGG - Intergenic
1138006258 16:53340684-53340706 ACCTGTTGTCCCAAGCTACTTGG + Intergenic
1138880161 16:61003723-61003745 ACCTGTAATTCCCAGCTACTTGG - Intergenic
1139214043 16:65109993-65110015 GCCTGTAGTCCCCAGCTACTCGG - Intronic
1139458485 16:67103447-67103469 ACCTCTAAGTCCCAGCTACTTGG + Intergenic
1139519302 16:67471311-67471333 GCCTGTAATCCCCAGCTACTTGG - Intronic
1139661877 16:68426478-68426500 AGCAGTAGGGACAAGCTACTAGG - Intronic
1139677697 16:68536430-68536452 GCCGGTAGTCCCCAACTACTGGG - Intronic
1139821912 16:69727424-69727446 GCCTGTAAGTCCCAGCTACTCGG + Intergenic
1139988872 16:70922890-70922912 GCCTGTAGTCCCAAGCTACTTGG - Intronic
1140154862 16:72413611-72413633 GCCTGTAAGTCCCAGCTACTTGG + Intergenic
1140629733 16:76836870-76836892 GCCTGTAAGTCCCAGCTACTCGG - Intergenic
1141105166 16:81227398-81227420 ACCTGTAGTTCCCAGCAACTCGG - Intergenic
1141179318 16:81741683-81741705 GCCTGTAGTCCCCAGCTCCTTGG + Intronic
1141198301 16:81878105-81878127 GCCTGTAGTCCCCAGCTACTCGG - Intronic
1141420178 16:83909745-83909767 GCCTGTAATCCCCAGCTACTCGG - Intronic
1142004879 16:87684957-87684979 ACCAGGAGGCCCCAGAGAATGGG + Intronic
1142018200 16:87763477-87763499 ACCTGTAGTCCCAAACTACTCGG + Intronic
1142705679 17:1692470-1692492 GCCTGTAACCCCCAGCTACTCGG - Intergenic
1142710295 17:1719420-1719442 GCCTGTAGTGCCCAGCTACTTGG + Intronic
1142736424 17:1903143-1903165 ACCTGTAAATCCCAGCTACTCGG - Intergenic
1143055522 17:4159128-4159150 GCCTGTAATCCCCAGCTACTTGG - Intronic
1143537064 17:7547952-7547974 GCCTGTAGTTCCCAGCTACTCGG - Intergenic
1143655680 17:8292231-8292253 GCCTGTAGTCCCAAGCTACTCGG + Intronic
1143660821 17:8323641-8323663 GCCTGTAAGTCCCAGCTACTCGG + Intergenic
1143878314 17:10010273-10010295 GCCTGTAAGTCCCAGCTACTCGG - Intronic
1143910985 17:10248844-10248866 GCCTGTAGGTCCCAGCTACTCGG + Intergenic
1143961910 17:10728432-10728454 GCCTGTAGTCCCCAGCTACTAGG - Intronic
1144492808 17:15729319-15729341 GCCTGTAAGTCCCAGCTACTCGG + Intergenic
1144687867 17:17237946-17237968 GCCTGTAGTCCCCAGCTACTCGG - Intergenic
1144786154 17:17832793-17832815 ACCTATAGTCCCAAGCTACTCGG + Intronic
1144812463 17:18009281-18009303 ACCTGGTGGTCCCAGCTACTTGG + Intronic
1144815333 17:18030379-18030401 GCCTGTAGTCCCCAGCTACTAGG + Intronic
1144907445 17:18647340-18647362 GCCTGTAAGTCCCAGCTACTCGG - Intronic
1144936788 17:18905703-18905725 GCCTGTAATCCCCAGCTACTTGG - Intronic
1145105860 17:20116211-20116233 ACCTGTAGTCCCAAGCTACTCGG - Intronic
1145107292 17:20129308-20129330 GCCTGTAGTCCCCAGCTACTCGG - Intronic
1145120084 17:20251100-20251122 GCCTGTAACCCCCAGCTACTTGG + Intronic
1145739725 17:27263106-27263128 ACCTGTAAGTCCCAGCTACTTGG + Intergenic
1145923559 17:28629413-28629435 ACCTGTAATCCCCAGGTACTTGG - Intronic
1146092324 17:29892163-29892185 GTCTGTAGTCCCCAGCTACTTGG - Intronic
1146265069 17:31447337-31447359 ACCTGTGTGTCCCAGCTACTTGG + Intronic
1146268046 17:31466016-31466038 GCCTGTAAGTCCCAGCTACTCGG + Intronic
1146702456 17:34973213-34973235 ACCTGTGGGTCCCAGGTACTTGG + Intronic
1146978457 17:37136815-37136837 GCCTGTAGTCCCTAGCTACTTGG + Intronic
1147136844 17:38439049-38439071 ACCTGTAAATCCCAGCTACTTGG + Intronic
1147208523 17:38856703-38856725 GCCTGCAGTCCCCAGCTACTCGG + Intergenic
1147280453 17:39356087-39356109 ACCTGTAATCCCCTGCTACTTGG + Intronic
1147399873 17:40174312-40174334 GCCTGTAAACCCCAGCTACTTGG - Intergenic
1147498687 17:40941911-40941933 GCCTGTAAGTCCCAGCTACTGGG - Intergenic
1147704604 17:42417329-42417351 ACCTGTAAATCCCAGCTACTCGG + Intronic
1147712459 17:42479029-42479051 GCCTGTAATCCCCAGCTACTCGG - Intronic
1147729519 17:42589556-42589578 ACCTGTGGTCCCCAGCTACTTGG - Intronic
1147732081 17:42610216-42610238 ACCAGGTGCCCCCAGCGACTTGG + Exonic
1147739039 17:42659942-42659964 ACCAGGTGCCCCCAGCGACTTGG + Exonic
1147849818 17:43433271-43433293 GCCTGTAGTCCTCAGCTACTCGG + Intergenic
1147881524 17:43657296-43657318 ACCTGTAAATCCCAGCTACTTGG - Intronic
1147985357 17:44303917-44303939 ACCTGGATTCCCCAGCTACTTGG - Intergenic
1148191752 17:45683593-45683615 GCCTGTAAGTCCCAGCTACTTGG + Intergenic
1148336521 17:46845613-46845635 ACCTGTAGTCCCCAGCTACTCGG - Intronic
1148374759 17:47133261-47133283 GCCTGTAATCCCCAGCTACTCGG - Intronic
1148380391 17:47192522-47192544 ACCTGTGGTCCCCAGCTGCTGGG + Intergenic
1148504565 17:48117178-48117200 GCCTGTAATCCCCAGCTACTCGG - Intronic
1148606242 17:48931407-48931429 ACCAGGCTGCCCCTGCTACTTGG - Intronic
1148814032 17:50313866-50313888 GCCTGTAGTCCCCAGCTACTTGG + Intergenic
1148922325 17:51049720-51049742 ACCTGTAGTACCCAGCTACTTGG - Intronic
1149152947 17:53591921-53591943 ACCTGTAGTCCCAAACTACTCGG - Intergenic
1149414643 17:56446777-56446799 ACCTGTGGTCCCCAGCTACTAGG + Intronic
1149476288 17:56963784-56963806 GCCTGTAGTCCCCAGCTACTCGG - Intergenic
1149580832 17:57749353-57749375 ACCTGTAGTCCCAAGCTACTTGG + Intergenic
1149892678 17:60403913-60403935 GCCTGTGGGTCCCAGCTACTTGG + Intronic
1149904620 17:60514179-60514201 ACCTGTAAGTCCCAGCTACTAGG + Intronic
1150027832 17:61696858-61696880 ACCTGTAGTCCCCAGCTACTCGG + Intronic
1150352407 17:64455913-64455935 ACCTGTAATCCCCAGCTACTTGG + Intronic
1151600214 17:75101434-75101456 ACCTGTAAATCCCAGCTACTTGG + Intronic
1151764598 17:76125707-76125729 ACCTGTAGTCCCCAGCTACTGGG + Intergenic
1151835858 17:76582295-76582317 GCCTGTAAGCCACAGCTACTTGG - Intronic
1151868866 17:76822961-76822983 ACCTGTTAGTCCCAGCTACTCGG - Intergenic
1152106736 17:78334406-78334428 ACCAGTAGCTCCCAGCTACTCGG + Intergenic
1152820073 17:82433315-82433337 GCCTGTAATCCCCAGCTACTGGG + Intronic
1152977450 18:236479-236501 GCCTGTAGTTCCCAGCTACTCGG - Intronic
1153279412 18:3400170-3400192 GCCTGTAATCCCCAGCTACTCGG + Intergenic
1153747801 18:8198270-8198292 GTCTGTAGGTCCCAGCTACTTGG - Intronic
1154076329 18:11205533-11205555 GCCTGTAGGCCCCAGCTACTTGG + Intergenic
1154219676 18:12441116-12441138 GCCTGTAGTCCCCAACTACTCGG + Intergenic
1154293759 18:13132328-13132350 GCCTATAGTCCCCAGCTACTTGG + Intergenic
1154468353 18:14671738-14671760 ACCTGTAAGTCCCAGCTACTTGG - Intergenic
1154473204 18:14724778-14724800 ACCTGTAATTCCCAGCTACTCGG - Intergenic
1154482276 18:14843666-14843688 AGAAGTAAGTCCCAGCTACTCGG + Intronic
1155302936 18:24449238-24449260 ACCTGTAGGTCCCAGCTACTTGG + Intronic
1155474395 18:26223816-26223838 GCCTGTGGTCCCCAGCTACTTGG + Intergenic
1155939244 18:31787142-31787164 ACCTGTAAGTCCCAGCTACTCGG - Intergenic
1156300305 18:35830657-35830679 ACCTGTAGTCCCCAGCTATCAGG + Intergenic
1156408065 18:36801457-36801479 ACCTATGGACCCCAGCTACTTGG - Intronic
1157350833 18:46883879-46883901 ACCTGTGGGTCCCAGCAACTTGG + Intronic
1157784166 18:50467232-50467254 ACAAATAAGCCCCAGCTACAGGG + Intergenic
1157899523 18:51501083-51501105 ACCAGGTGACCCCAGCTGCTGGG + Intergenic
1159583057 18:70254681-70254703 ACCTGTAATCCCAAGCTACTTGG + Intergenic
1159937080 18:74377547-74377569 GCCTGCAGGTCCCAGCTACTTGG + Intergenic
1160923712 19:1533007-1533029 ATCAGTAGGTCCCAGCTACTTGG + Intronic
1161079024 19:2301172-2301194 ACCAGGGGTCCCCAGCTCCTGGG - Intronic
1161212588 19:3075332-3075354 ACCAGGGGGCCCCAGCTCCTGGG + Intergenic
1161363540 19:3865473-3865495 ACCTATAGTCCCCAGCTGCTTGG - Intronic
1161627055 19:5333379-5333401 GCCTATAGTCCCCAGCTACTTGG + Intronic
1161798026 19:6398861-6398883 ACCTGTAATCCCCAGCTACTCGG + Intergenic
1161912808 19:7207289-7207311 ACCTGTAATCCCCAGCTGCTCGG + Intronic
1162047406 19:8009690-8009712 AGCAGGCGGTCCCAGCTACTTGG - Intronic
1162073251 19:8167608-8167630 ACCTGTAAGTCCCAGCCACTCGG + Intronic
1162095418 19:8307164-8307186 GCCTGTAGTCCCAAGCTACTCGG + Intronic
1162180452 19:8865415-8865437 ACCTGTAAATCCCAGCTACTTGG + Intronic
1162358231 19:10200678-10200700 GCCTGTGGGTCCCAGCTACTTGG - Intronic
1162376623 19:10309005-10309027 GCCTGTAAGTCCCAGCTACTCGG - Exonic
1162411006 19:10505128-10505150 GCCTGTAATCCCCAGCTACTCGG + Intergenic
1162661104 19:12169732-12169754 GCCTGTAAGTCCCAGCTACTCGG - Intronic
1162895112 19:13760716-13760738 GCCTGTGGGTCCCAGCTACTTGG - Intronic
1163007111 19:14404000-14404022 ACCTGTAAATCCCAGCTACTTGG - Intronic
1163096637 19:15062775-15062797 ACCTGTAAGTTCCAGCTACTTGG + Intergenic
1163147310 19:15389097-15389119 GCCTATAGTCCCCAGCTACTTGG + Intronic
1163160967 19:15464023-15464045 AGCAGGAGGCCCCAGGTACATGG - Exonic
1163276707 19:16289208-16289230 ACCTGTAAGTCCCAGCTACTCGG - Intergenic
1163399440 19:17083158-17083180 GCCTGTAGTCCCAAGCTACTAGG - Intronic
1163481209 19:17557424-17557446 ACCTGTAATCCCAAGCTACTCGG - Intronic
1163578817 19:18125931-18125953 GCCTGTAGATCCCAGCTACTTGG + Intronic
1163607652 19:18283906-18283928 GCCTGTAGTCCCCAGCTACTCGG + Intergenic
1163809841 19:19424047-19424069 ACCTGTAGTCCCAAGTTACTCGG - Intronic
1164186562 19:22874640-22874662 ACCTGTAAATCCCAGCTACTTGG - Intergenic
1164240959 19:23388746-23388768 ACCTGTAATCCCAAGCTACTTGG + Intronic
1164537002 19:29093331-29093353 ACCAGGATGCCCCGCCTACTCGG + Intergenic
1165313457 19:35041585-35041607 ACCAGGCGGGCCCAGCTACGGGG - Intronic
1165398531 19:35582301-35582323 ACCTGTAGCCCCAAGCTACTTGG - Intergenic
1165666950 19:37639470-37639492 ACCTGTAATCCCCAACTACTTGG + Intronic
1166027126 19:40096962-40096984 ACCTGTGGTCCCAAGCTACTTGG - Intergenic
1166070137 19:40382226-40382248 ACCGGTAGTTCCAAGCTACTTGG - Intronic
1166193113 19:41188980-41189002 GCCTGTAGTCCCCAGCCACTGGG - Intergenic
1166708113 19:44919849-44919871 ACCTGTAAATCCCAGCTACTTGG - Intergenic
1166776491 19:45315967-45315989 ACCTGTTAGTCCCAGCTACTTGG - Intronic
1167066972 19:47193700-47193722 ACCTGTAATCCCCAGTTACTTGG + Intronic
1167429180 19:49444468-49444490 ACCTGTTGTCCTCAGCTACTCGG - Intergenic
1167995761 19:53400955-53400977 ACCTGTGGTTCCCAGCTACTTGG - Intronic
1168025856 19:53643171-53643193 ACCTGTTGGTCCTAGCTACTTGG - Intergenic
1168180250 19:54657546-54657568 ATCAGGAGGCTCCTGCTACTCGG - Intronic
1168534655 19:57158856-57158878 ACCTGTAAATCCCAGCTACTTGG + Intronic
925396197 2:3535299-3535321 GCCTCTAGTCCCCAGCTACTTGG + Intronic
926088201 2:10033212-10033234 ACCTGGAGGCCCCAGCCTCTTGG - Intergenic
926284289 2:11475482-11475504 ACCTGTAGTCCCCAGCTATTTGG + Intergenic
926661376 2:15470833-15470855 GCCTGTAGTCCCAAGCTACTTGG + Intronic
926948355 2:18213842-18213864 GCCTGTAATCCCCAGCTACTCGG - Intronic
927193167 2:20530969-20530991 GCCTGTAGTTCCCAGCTACTCGG - Intergenic
927238681 2:20901204-20901226 GCCTGTAGTCCCCAGCTACTGGG + Intergenic
927545142 2:23945954-23945976 ACCTATAATCCCCAGCTACTCGG - Intronic
927545528 2:23949444-23949466 GCCTGTAGTCCCCAGCTACTCGG + Intronic
927563839 2:24093739-24093761 CCCTGTAGTCCCAAGCTACTTGG - Intronic
927771406 2:25865304-25865326 ACCTTTAAGTCCCAGCTACTTGG + Intronic
927774810 2:25894380-25894402 ACCTGTAGTCCCAAGCTACCTGG - Intergenic
929219517 2:39449055-39449077 GCCTGTAGTCCCCAGCTACTCGG + Intergenic
929509882 2:42558364-42558386 CCCAGTTAGTCCCAGCTACTTGG - Intronic
929519174 2:42632213-42632235 GCCTGTAGAACCCAGCTACTTGG - Intronic
929636181 2:43523238-43523260 ACCCGTAAGTCCTAGCTACTTGG + Intronic
929703602 2:44187873-44187895 ACCTGTAAGTCCCAGCTACTAGG - Intronic
929762095 2:44815116-44815138 ACCAGGAGGCCCCTCCTAATGGG - Intergenic
930112065 2:47687113-47687135 ACATGTAGTCCCCAGCTACTCGG - Intergenic
930176485 2:48306306-48306328 ACCTGTAAATCCCAGCTACTTGG - Intergenic
930198677 2:48532221-48532243 ACCTGTAATTCCCAGCTACTTGG + Intronic
930314019 2:49775576-49775598 GCCTGTAGTCCCCAGCTACTTGG - Intergenic
931097802 2:58961795-58961817 ACCTGTAGCCCCCAGCTACTCGG - Intergenic
931280334 2:60785646-60785668 GCCTGCAGGCCCCAGCTACTTGG - Intronic
931346801 2:61454248-61454270 GCCTGTAATCCCCAGCTACTTGG - Intronic
931691563 2:64838520-64838542 ACCTGTAATCCCAAGCTACTTGG - Intergenic
932536291 2:72600314-72600336 ACCTGTTAGTCCCAGCTACTGGG + Intronic
933541095 2:83643747-83643769 ACCAGGAGGGCCAAGCTACCAGG - Intergenic
933676345 2:85061009-85061031 GCCTGTAGCTCCCAGCTACTCGG - Intergenic
933751331 2:85603715-85603737 GCCTGTAGTTCCCAGCTACTCGG - Intronic
933756920 2:85647011-85647033 GCCTGTAGGTCCCAGCTACTTGG - Intronic
933863785 2:86497707-86497729 ACCTGTAGTTCCCAGCAACTTGG - Intergenic
933996314 2:87672530-87672552 ACCAGTGGCTCCCAGCCACTGGG - Intergenic
934182065 2:89633708-89633730 GCCTGTAAGTCCCAGCTACTCGG - Intergenic
934738392 2:96701986-96702008 GCCAGGAGGCCCCAGCTTCTTGG - Intergenic
934864637 2:97795475-97795497 ATCACTAGGCCCCAGCCAGTTGG - Intronic
935988010 2:108693285-108693307 ACCTGTAGTCCCCAGCTACTTGG - Intergenic
936056159 2:109263841-109263863 GCCTGTAGTCCCCAGCTGCTCGG + Intronic
936225462 2:110645685-110645707 GCCTGTAAGTCCCAGCTACTTGG - Intronic
936297541 2:111278381-111278403 ACCAGTGGCTCCCAGCCACTGGG + Intergenic
936582736 2:113718207-113718229 ACCTGCAGTCCCAAGCTACTTGG - Intronic
936698950 2:114986894-114986916 GCCTGTAATCCCCAGCTACTTGG - Intronic
937149806 2:119678820-119678842 GCCTGTAGTCCCCAGCTGCTGGG - Intergenic
937245623 2:120490785-120490807 GCCTGTAGTCCCCAGCTACTCGG + Intergenic
937946563 2:127343892-127343914 GCCTGTAGCTCCCAGCTACTTGG + Intronic
938017887 2:127883220-127883242 GCCTGTAGTCCTCAGCTACTTGG - Intronic
938027285 2:127961112-127961134 ACCTGTGGTCCCAAGCTACTGGG - Intronic
938343650 2:130551185-130551207 GCCTGTAAGTCCCAGCTACTGGG + Intergenic
938346183 2:130569537-130569559 GCCTGTAAGTCCCAGCTACTGGG - Intergenic
938917325 2:135955778-135955800 GCCTGTAGTCCCCAGCTACCTGG - Intronic
938986924 2:136585488-136585510 ACCTGTAGTCCCAAGCTACTCGG - Intergenic
939344513 2:140946473-140946495 ACCTGTAGTCCCAAGCTACTTGG + Intronic
939928684 2:148205200-148205222 GCCTGTAATCCCCAGCTACTTGG - Intronic
940237234 2:151524790-151524812 ACCTGCAGTCCCCAGCTACTCGG - Intronic
940248862 2:151651043-151651065 ACCTGTAAATCCCAGCTACTAGG - Intronic
940892005 2:159044310-159044332 ACCTGTAGTCCCAAGCTACTCGG + Intronic
941822568 2:169857197-169857219 GCCTGTAAGTCCCAGCTACTCGG - Intronic
941828482 2:169926461-169926483 ACCTGTAAATCCCAGCTACTCGG + Intronic
941940906 2:171036318-171036340 ACCTGTAAACCCCAGCTATTTGG + Intronic
942021289 2:171868437-171868459 GCCTGTAATCCCCAGCTACTCGG - Intronic
942233813 2:173884929-173884951 ACCTGTAAGTCCCAGCTACTTGG - Intergenic
942261221 2:174165998-174166020 GCCTGTAGTCCCCAGCTACTTGG + Intronic
942269865 2:174263595-174263617 ACCTGTACATCCCAGCTACTTGG + Intergenic
942335782 2:174884091-174884113 GCCTGTAGCTCCCAGCTACTCGG - Intronic
943440217 2:187918533-187918555 GCCTGTAAGTCCCAGCTACTCGG - Intergenic
944120534 2:196235779-196235801 GCCTGTAGTCCCCAGCTACTCGG - Intronic
944258834 2:197654259-197654281 GCCTGTAAGTCCCAGCTACTTGG + Intronic
944523867 2:200598616-200598638 ACCTGTAGTCCCAAGCTACTCGG + Intronic
945095627 2:206216327-206216349 ACCTGTAGTCCCCAGCTACTTGG + Intronic
945317668 2:208388189-208388211 ACCTGTAGCCCCCAGCTACTCGG + Intronic
945476994 2:210295518-210295540 GCCTGTAGTCCCCAGCTACTTGG + Intronic
945625407 2:212198695-212198717 ACCTGTAATCCCTAGCTACTGGG - Intronic
945736624 2:213608809-213608831 GCCTGTAGTCCCCAGCTACTCGG - Intronic
945883851 2:215354151-215354173 ACCTGTGGTCCCCAGCTACTCGG - Intergenic
945907315 2:215609676-215609698 AACTATAGACCCCAGCTACTTGG - Intergenic
945998859 2:216463915-216463937 GCCTGTAAGTCCCAGCTACTCGG + Intronic
946198687 2:218056951-218056973 GCCTGTAGTCCCCAGCTACTTGG + Intronic
946285450 2:218699127-218699149 CCCAGTATGACCCAGCTGCTTGG + Exonic
946303069 2:218836632-218836654 GCCTGTAAGTCCCAGCTACTTGG + Intergenic
946559080 2:220892322-220892344 ATCAGTGAGCCCCAGCTAATGGG - Intergenic
946746959 2:222855634-222855656 GCCTATAGTCCCCAGCTACTTGG - Intergenic
946827390 2:223692920-223692942 ACCTGTAATCCCAAGCTACTCGG - Intergenic
947095584 2:226563032-226563054 ATCTATAGTCCCCAGCTACTGGG + Intergenic
948011513 2:234652721-234652743 GCCTATAGTCCCCAGCTACTTGG - Intergenic
948931030 2:241132389-241132411 GCCTGTAGTCCCCAGCTACTCGG + Intronic
948956198 2:241293794-241293816 GCCTGTAGTCCCCAGCTACTTGG + Intronic
1168781717 20:497406-497428 ACCTGTAAGTCCCAGCTACTTGG - Intronic
1169089534 20:2850196-2850218 GCCTGTAATCCCCAGCTACTTGG + Intronic
1169247810 20:4037672-4037694 GCCTGTAGTCCCCAGCTACTCGG - Intergenic
1169299984 20:4433573-4433595 ACCAGTAGGCTCCCACCACTTGG - Intergenic
1169737865 20:8856489-8856511 GCCTGTAGTTCCCAGCTACTGGG + Intronic
1169756606 20:9049795-9049817 GCCTGTAGTCCCCAGCTACTCGG - Intergenic
1170007271 20:11683160-11683182 GCCTGTAAGTCCCAGCTACTCGG - Intergenic
1170007517 20:11685651-11685673 GCCTGTAAGTCCCAGCTACTTGG - Intergenic
1170234606 20:14088202-14088224 GCCTGTAAGTCCCAGCTACTCGG + Intronic
1171118045 20:22543984-22544006 GCCTATAGTCCCCAGCTACTTGG + Intergenic
1171483441 20:25469766-25469788 ACCTGAACGCCCCAGCTCCTTGG - Intronic
1172233502 20:33353160-33353182 GCCTGTAAGTCCCAGCTACTTGG + Intergenic
1172496468 20:35388938-35388960 GCCTGTAGTCCCCAGCTACTCGG + Intronic
1172537240 20:35683654-35683676 CCCTGTAGTCCCAAGCTACTAGG + Intronic
1172586406 20:36088307-36088329 GCCTGTAAGTCCCAGCTACTCGG - Intergenic
1172654962 20:36531184-36531206 GCCTATAGTCCCCAGCTACTTGG - Intergenic
1172989569 20:39023471-39023493 GCCTCTAAGCCCCAGCTACTAGG - Intronic
1173151898 20:40573686-40573708 ACCTGTTAGTCCCAGCTACTTGG + Intergenic
1173214417 20:41067243-41067265 GCCTGTAAGTCCCAGCTACTCGG - Intronic
1173313339 20:41920430-41920452 CCCTGTGGTCCCCAGCTACTTGG + Intergenic
1174335349 20:49855913-49855935 GCCTGTAAGTCCCAGCTACTCGG - Intronic
1174369204 20:50074983-50075005 GCCTGTAATCCCCAGCTACTCGG + Intergenic
1174378652 20:50142561-50142583 GCCTGTAGGTCCCAGCTACTTGG - Intronic
1174535830 20:51250770-51250792 ACCTGTAGTTCCTAGCTACTTGG - Intergenic
1174575117 20:51531734-51531756 TCCAGTAGGCCCCATTTACTGGG - Intronic
1174672782 20:52323549-52323571 GCCTGTAGTCCCCAGCTACTTGG - Intergenic
1175183795 20:57166439-57166461 GCCTGTAGTCCCCAGCTACTCGG + Intergenic
1175481815 20:59317033-59317055 AGCGGTAGGCCCCAGCCACTGGG + Intronic
1175609854 20:60341744-60341766 GCCTGTAGTACCCAGCTACTTGG + Intergenic
1175855930 20:62121247-62121269 ACGTGTAATCCCCAGCTACTCGG - Intergenic
1176068352 20:63212444-63212466 CCAAGTAGCCCTCAGCTACTGGG - Intronic
1176139831 20:63540064-63540086 ACCCGTACGCTCCAGCTCCTGGG + Intergenic
1176202451 20:63868037-63868059 GCCTGTAGTTCCCAGCTACTTGG - Intronic
1176224985 20:63992209-63992231 ACCTGTAATCCCCAGCTACCTGG - Intronic
1176768068 21:13039335-13039357 GCCTGTAGTCCCCAGCTAATTGG + Intergenic
1176798331 21:13392951-13392973 AGAAGTAAGTCCCAGCTACTCGG - Intergenic
1176806164 21:13485912-13485934 ACCTGTAAGTCCCAGCTACTTGG + Intergenic
1177173397 21:17678101-17678123 AGCAGGTGTCCCCAGCTACTGGG + Intergenic
1177185818 21:17794932-17794954 GACAGTAAGTCCCAGCTACTCGG + Intronic
1178399922 21:32276801-32276823 ATCTGTAGTCCCAAGCTACTTGG + Intronic
1178471145 21:32893967-32893989 GCCTGTAAGTCCCAGCTACTTGG - Intergenic
1178683597 21:34694096-34694118 TGCTGTAGTCCCCAGCTACTTGG - Intronic
1178706116 21:34874482-34874504 GCCTGTAATCCCCAGCTACTTGG + Intronic
1178996215 21:37402886-37402908 ACCTGTAAATCCCAGCTACTTGG - Intronic
1179214605 21:39356322-39356344 GCCTGTAAGTCCCAGCTACTCGG + Intergenic
1180117735 21:45722886-45722908 ACCTGTAGTCCCAAGCTGCTTGG + Intronic
1180643969 22:17322388-17322410 ACCTGTAAATCCCAGCTACTTGG + Intergenic
1180789102 22:18564569-18564591 GCCTGTAATCCCCAGCTACTCGG - Intergenic
1181095537 22:20502820-20502842 GCCTGTAGTCCCCAGCTACTTGG + Intronic
1181232637 22:21430743-21430765 GCCTGTAATCCCCAGCTACTCGG + Intronic
1181246014 22:21504114-21504136 GCCTGTAATCCCCAGCTACTCGG - Intergenic
1181384289 22:22532618-22532640 GCCTGCAGGTCCCAGCTACTGGG - Intergenic
1181828091 22:25536048-25536070 ACCTGTAGTCCCCAGCTACTTGG + Intergenic
1181939956 22:26468026-26468048 ACCTGTAAATCCCAGCTACTTGG - Intronic
1182079879 22:27521456-27521478 GCCTGTAAGTCCCAGCTACTCGG + Intergenic
1182366642 22:29783697-29783719 ATCTGTAGTCTCCAGCTACTTGG - Intergenic
1182723357 22:32422580-32422602 GCCAGTAATCCCCAGCTACTCGG + Intronic
1182934140 22:34205130-34205152 ACCTGTAAGTCCCAGCTACTTGG - Intergenic
1183012160 22:34955725-34955747 GCCTGTAGTTCCCAGCTACTCGG + Intergenic
1183061150 22:35337059-35337081 GCCTGTAGTCCCCAGCTACTCGG - Intronic
1183118471 22:35711042-35711064 GCCCGTAATCCCCAGCTACTTGG + Intergenic
1183514128 22:38253443-38253465 GCCTGTAATCCCCAGCTACTTGG + Intronic
1183814338 22:40287132-40287154 ATCTGTAGTCCCCAGCTACTTGG - Intronic
1183891804 22:40935852-40935874 GCCTGTAAGTCCCAGCTACTCGG + Intergenic
1183923048 22:41184554-41184576 GCCTGTAAGTCCCAGCTACTCGG + Intergenic
1183973488 22:41496187-41496209 GCCTGTAGTGCCCAGCTACTTGG + Intronic
1184014658 22:41776937-41776959 ACCTGTAAGTCCCAGCTACTTGG - Intronic
1184083394 22:42242075-42242097 GCCTGTAAGTCCCAGCTACTCGG + Intronic
1184702989 22:46189829-46189851 GCCTGTAGTCCCTAGCTACTTGG - Intronic
1184752741 22:46498121-46498143 ACCTGTAAGTCCCAGCTACTCGG + Intronic
1185326947 22:50230650-50230672 GCCTGTTGGTCCCAGCTACTCGG + Intronic
949937955 3:9131562-9131584 ACCTGTAGTCCCCAGCTACTTGG - Intronic
949974308 3:9441085-9441107 ACCTGTAAGTCCCAGCTACTGGG + Intronic
950025431 3:9816865-9816887 ACCAGTAAGGCCCATCTTCTGGG + Intronic
950283085 3:11723453-11723475 GCCTGTAAGTCCCAGCTACTTGG + Intergenic
950666646 3:14499596-14499618 GCCTGTAGTCCCCAGCTACTCGG + Intronic
950739267 3:15036613-15036635 GCCTGTAAGTCCCAGCTACTTGG - Intronic
950879463 3:16311318-16311340 GCCTGTAATCCCCAGCTACTCGG - Intronic
951017782 3:17748508-17748530 ACCTGTAGGTCCCAGCTACATGG - Intronic
951032781 3:17901489-17901511 ACCTTTAAGCCCCAGATACTTGG + Intronic
951502245 3:23401804-23401826 GCCTGTAGTCCCAAGCTACTCGG - Intronic
951531796 3:23704970-23704992 GCCTGTTGGTCCCAGCTACTTGG - Intergenic
951548426 3:23852718-23852740 GCCTGTAAGTCCCAGCTACTGGG - Intronic
951973683 3:28478367-28478389 ACCTGTAATTCCCAGCTACTTGG - Intronic
952456187 3:33474262-33474284 ACCTGTAGTCCCCAGCTACTTGG + Intergenic
952529727 3:34251096-34251118 ACCTGTGGGTCCCAGCTACTTGG - Intergenic
952766325 3:36957179-36957201 TCCTGTAGGCCCCAGCCACAGGG + Intergenic
952944368 3:38467624-38467646 ACCTGTAAGTCCGAGCTACTTGG + Intronic
953146525 3:40281152-40281174 TCCTGTAGTCCCCAGCTACTTGG + Intergenic
953309777 3:41865145-41865167 TCCTGTAATCCCCAGCTACTTGG + Intronic
953609160 3:44433237-44433259 ACCTGTAAATCCCAGCTACTGGG - Intergenic
953707721 3:45243859-45243881 CCCTGTAGTCCCCAGCCACTTGG + Intergenic
953737105 3:45504953-45504975 GCCTGTAGCCCCCAGCTACTAGG + Intronic
953838872 3:46372400-46372422 GCCTGTAGTCCCCAGCCACTTGG + Intronic
954016610 3:47697424-47697446 ACCTGTAGTCCCAGGCTACTCGG - Intronic
954026257 3:47785625-47785647 GCCTGTAATCCCCAGCTACTTGG + Intergenic
954066162 3:48108216-48108238 ACCTGCAGTCCCAAGCTACTCGG - Intergenic
954248238 3:49348511-49348533 GCCTGTAGTCCCCAGCTACTGGG - Intergenic
954790256 3:53127574-53127596 GCCTGTAAGTCCCAGCTACTCGG + Intronic
954863646 3:53711119-53711141 GCCTATAGTCCCCAGCTACTTGG + Intronic
955173994 3:56594555-56594577 GCCTGTAGTCCCCAGCTACTCGG + Intronic
955339001 3:58110386-58110408 GCCTGTAGTCCCCAGCTACTTGG - Intronic
955539878 3:59963139-59963161 ACCTGTAGTCCCCAGCTACTTGG + Intronic
955709035 3:61759529-61759551 GCCTGTAAGTCCCAGCTACTCGG + Intronic
956554620 3:70505006-70505028 ACCAGTAGGCCCCACCTCATGGG + Intergenic
956730821 3:72194989-72195011 ACCTGTAGTCCCCAGCTACTCGG + Intergenic
956824017 3:72980698-72980720 ACCTGTAAATCCCAGCTACTGGG - Intronic
956841765 3:73146710-73146732 GCCTGTAAGTCCCAGCTACTCGG - Intergenic
957923191 3:86773000-86773022 CCCAGTAGGCCCGAGCTACTAGG + Intergenic
958801202 3:98757959-98757981 GCCTGTAGTCCCAAGCTACTTGG - Intronic
959050008 3:101515205-101515227 ACCTATAGTCCCCGGCTACTGGG + Intergenic
959131532 3:102362492-102362514 ACCTGTAGTTCCCAGGTACTCGG + Intronic
960654636 3:119989518-119989540 GCCTGTAGTCCCAAGCTACTCGG + Intronic
960665157 3:120101608-120101630 GCCTGTAAGTCCCAGCTACTTGG - Intergenic
960792448 3:121448489-121448511 ACCTGCAAGTCCCAGCTACTCGG - Intronic
960998790 3:123358472-123358494 ACCAGGTAGTCCCAGCTACTTGG + Intronic
961686300 3:128634200-128634222 GCCTGTAAGTCCCAGCTACTGGG + Intronic
961824388 3:129591368-129591390 GCCTGTAGTTCCCAGCTACTTGG + Intronic
962129379 3:132656617-132656639 ACCTGTAAATCCCAGCTACTCGG - Intronic
962437587 3:135380952-135380974 ACCAGGTAGCCCCAGCTCCTGGG + Intergenic
962517057 3:136162061-136162083 ACCTGTAAATCCCAGCTACTCGG - Intronic
962544333 3:136416969-136416991 GCCTGTAGTCCCCAGCTACTTGG - Intronic
962582767 3:136813049-136813071 CCCTGTAGTTCCCAGCTACTTGG - Intergenic
962586950 3:136851370-136851392 GCCTGTAGTTCCCAGCTACTCGG + Intronic
962859486 3:139386377-139386399 ACCTGTAGTCCCCAGCTACTCGG - Intronic
963128784 3:141839212-141839234 GCCTGTAGTCCCCCGCTACTCGG - Intergenic
963395712 3:144730815-144730837 GCCAGGAGGTCCCAGATACTTGG + Intergenic
963821779 3:149904504-149904526 GCCTGTAGCCCCCAGCTGCTGGG - Intronic
963826501 3:149960464-149960486 GCCTGTAGTCCCCAGCTACTAGG + Intronic
963875610 3:150471151-150471173 GCCTGTAAGTCCCAGCTACTCGG - Intergenic
963876248 3:150478896-150478918 GCCTGTAGTCCCCAGCTACTTGG - Intergenic
964121501 3:153189184-153189206 ATCTGTAAGTCCCAGCTACTTGG - Intergenic
964440148 3:156700231-156700253 ACCTGTAAGTCCCAGCTACTTGG - Intronic
964973436 3:162589136-162589158 GCCTGTGGTCCCCAGCTACTGGG - Intergenic
965756181 3:172029738-172029760 GCCTGTAGTCCCAAGCTACTAGG + Intergenic
965792092 3:172400880-172400902 GCCTGTAATCCCCAGCTACTTGG - Exonic
965991808 3:174828055-174828077 ACCTGTAGTCCCCAGCTACTTGG + Intronic
966719642 3:183049444-183049466 ACCTGTAGTTCCCAGCTACTCGG + Intronic
966755498 3:183367349-183367371 GCCTGTAATCCCCAGCTACTTGG - Intronic
966810171 3:183836863-183836885 ACCTGTTAGTCCCAGCTACTTGG - Intronic
967023979 3:185547697-185547719 ACCTGTAATCCCCAGTTACTTGG + Intronic
967129915 3:186460806-186460828 ACCTGTTAGTCCCAGCTACTTGG - Intergenic
967163649 3:186761090-186761112 ACCTGTAAATCCCAGCTACTCGG - Intergenic
967264979 3:187682618-187682640 ACCTGTAAGTCCTAGCTACTTGG + Intergenic
968111532 3:196052005-196052027 ACCAGTTGGCTCTAGCTACTTGG - Exonic
968125804 3:196159355-196159377 ACCTGTAATCCCCAGCTACTTGG + Intergenic
968136172 3:196221014-196221036 GCCTGTGGTCCCCAGCTACTAGG - Intronic
968136873 3:196226194-196226216 ACCTGTAGTCCCAGGCTACTTGG + Intronic
968148873 3:196321491-196321513 AGCAGGAGGCCCCTGCTTCTAGG + Intronic
968211635 3:196853903-196853925 ACCTGTAAGTCCCAGCTACTAGG - Intergenic
968238264 3:197051295-197051317 CCAGGGAGGCCCCAGCTACTCGG + Intronic
968262835 3:197339092-197339114 CCAGGGAGGCCCCAGCTACTCGG - Intergenic
968315249 3:197718573-197718595 ATCTGTAGTTCCCAGCTACTCGG - Intronic
968639593 4:1706158-1706180 ACCAGTAGGCCCCAGCTACTAGG + Intronic
968736277 4:2298320-2298342 AACAGCAGGCCCCAGCTACATGG - Intronic
968779193 4:2566561-2566583 GCCTGTAGTCCCCAGCTACTCGG + Intronic
968822620 4:2866944-2866966 TCCTGTAGTCCCAAGCTACTTGG + Intronic
969682517 4:8651230-8651252 ACCTGTGGTCCCAAGCTACTTGG - Intergenic
970010597 4:11454748-11454770 ACCTGTTAGTCCCAGCTACTGGG + Intergenic
970799592 4:19956866-19956888 ACCTGTAAGTCCCTGCTACTTGG - Intergenic
971874614 4:32290712-32290734 ACCTGTAAGTCCCAGCTATTGGG - Intergenic
971987978 4:33851254-33851276 ACCTATAATCCCCAGCTACTCGG + Intergenic
972347849 4:38208484-38208506 GCCTGTAAGTCCCAGCTACTTGG + Intergenic
972527710 4:39932015-39932037 GCCTGTAGTTCCCAGCTACTTGG - Intronic
972561939 4:40236664-40236686 TCCCGTAGTCCCAAGCTACTTGG + Intronic
973267682 4:48227516-48227538 ACCTGTAAATCCCAGCTACTCGG + Intronic
973611135 4:52636933-52636955 ACCTGTAAGTCCCAGCTACTTGG - Intronic
973688459 4:53399417-53399439 ACAAATAGGTCCCAGATACTTGG - Intronic
973971706 4:56219471-56219493 ACCTGTAATCTCCAGCTACTCGG - Intronic
974061164 4:57037499-57037521 ACCTGTAGTCCCTAGCCACTCGG - Intronic
974606900 4:64164506-64164528 ACCCGTAGTCTCCAGCTACTCGG + Intergenic
975142973 4:70937040-70937062 GCCTGTAATCCCCAGCTACTCGG - Intronic
975341815 4:73250830-73250852 GCCAGTAAGTCCCAGCTACTTGG - Intronic
975351128 4:73348421-73348443 TTCTGTAGGTCCCAGCTACTTGG - Intergenic
975473688 4:74797605-74797627 GCCAGCAATCCCCAGCTACTTGG - Intergenic
975565562 4:75750607-75750629 ACCTATAGTCCCCAGCTACTCGG - Intronic
975624832 4:76335703-76335725 GCCTGTAGTCCTCAGCTACTGGG - Intronic
976459814 4:85296981-85297003 ACCTGCAAGTCCCAGCTACTTGG + Intergenic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
977184401 4:93918593-93918615 GCCTGTAGTTCCCAGCTACTTGG + Intergenic
977695048 4:99955711-99955733 GCCTGTAAGTCCCAGCTACTTGG + Intergenic
978239676 4:106500642-106500664 GCCTATAGGTCCCAGCTACTTGG - Intergenic
978660182 4:111117252-111117274 ACCTGTAGTTCCAAGCTACTCGG - Intergenic
978730005 4:112014316-112014338 GCCTGTAGGTCCCAACTACTCGG + Intergenic
978887653 4:113784233-113784255 ACCTGTAATTCCCAGCTACTCGG + Intergenic
978939849 4:114423085-114423107 GCCTGTAAGTCCCAGCTACTTGG + Intergenic
979165771 4:117528463-117528485 ACCTGTATTCCCCAGCTACTCGG - Intergenic
979580812 4:122357436-122357458 ACCTGTAGTCCCCAGCTACTCGG + Intronic
979692492 4:123574670-123574692 GCCTGTAGTCCCAAGCTACTTGG - Intergenic
979896994 4:126171461-126171483 ACCTGTAGTCCCCAGCTACTTGG - Intergenic
980017789 4:127673304-127673326 TCCTGTAGTCCCTAGCTACTTGG - Intronic
980345332 4:131608834-131608856 ACCCGTAGTCCCAAGCTACTTGG + Intergenic
980733616 4:136853379-136853401 ACCTGTAAGTCCCAGCTACTTGG - Intergenic
980914739 4:139023619-139023641 GCCTGTAATCCCCAGCTACTCGG - Intronic
980965190 4:139514157-139514179 ACCTGTTGGTACCAGCTACTTGG + Intronic
981126288 4:141110536-141110558 ACCTGTAGTCCCAAGCTACGTGG - Intronic
981232173 4:142369449-142369471 GCCTGTAGTCCCCCGCTACTTGG + Intronic
981661043 4:147166891-147166913 ACCTGTAGTTCCCAGCTAGTTGG + Intergenic
982028417 4:151275644-151275666 ACCTGAAGTCCCCAGCTACTCGG - Intronic
982049539 4:151486840-151486862 ACCTGTAATCCCAAGCTACTCGG + Intronic
982121005 4:152143713-152143735 ACCTGTAGTTCCAAGCTACTTGG + Intergenic
982201771 4:152968449-152968471 GCCTGTAGCCCCCAGCTACTCGG - Intronic
982717945 4:158828489-158828511 ACCTGTAAGTCCCAGCTACTTGG + Intronic
983390579 4:167125587-167125609 GCCTGTAGTCCCAAGCTACTCGG + Intronic
983654963 4:170073622-170073644 ACCTGTAGTCCCCAGCTACTCGG - Intronic
984433268 4:179675977-179675999 ACCTGTAGTCCCCAGCTACTTGG - Intergenic
984610390 4:181830392-181830414 ACCTGTAATCCCAAGCTACTTGG - Intergenic
984634482 4:182096002-182096024 GCCTGTAAGTCCCAGCTACTTGG + Intergenic
984895347 4:184534152-184534174 ATCTGTGGGTCCCAGCTACTTGG + Intergenic
984986342 4:185333921-185333943 GCTGGTAGTCCCCAGCTACTAGG + Intronic
985099385 4:186443041-186443063 ACCTGTAAATCCCAGCTACTTGG - Intronic
985173649 4:187178032-187178054 GCCTGTAAGTCCCAGCTACTCGG - Intergenic
985784149 5:1885510-1885532 GCCAGCAGGCCCCAGCGCCTGGG + Intronic
986681874 5:10240868-10240890 GCTTGTAGTCCCCAGCTACTAGG + Intronic
986860755 5:11923903-11923925 ATCAGGAGTCCCAAGCTACTTGG - Intergenic
987079014 5:14409707-14409729 GCCTGTAAGTCCCAGCTACTCGG + Intronic
987143060 5:14965020-14965042 GCCTATAGTCCCCAGCTACTCGG - Intergenic
987535788 5:19185331-19185353 AACAGTAGGAGCCAGCTAGTAGG - Intergenic
988790925 5:34606875-34606897 GCCTGTAGTCCCAAGCTACTCGG - Intergenic
989108718 5:37887093-37887115 ACCTGCAAGCCCCAGGTACTTGG - Intergenic
990150246 5:52809628-52809650 ACCTGTAATCCCCAGCTACTGGG - Intronic
990276720 5:54205058-54205080 ACCCGTAAATCCCAGCTACTTGG - Intronic
990403996 5:55469362-55469384 ACCTATAATCCCCAGCTACTTGG + Intronic
991609411 5:68435118-68435140 ACCTGAAGTTCCCAGCTACTCGG - Intergenic
991697175 5:69283914-69283936 ACCTGTAGTCCCTAGCTACATGG - Intronic
991702207 5:69326929-69326951 ACCTGTAGTCCCAAGCTACACGG + Intronic
991991516 5:72344385-72344407 GCCTGTAGGTCCCAGCTACTCGG + Intronic
992664248 5:78990614-78990636 ACCTGTAGTCCCCAGCTCCTCGG - Intergenic
994096860 5:95855097-95855119 GCCTGTAGTCCCCAGCTACTCGG - Intronic
996054351 5:118966903-118966925 GCCTGTAAGTCCCAGCTACTTGG + Intronic
996484175 5:124011975-124011997 ATCAGCAGGCTCAAGCTACTTGG - Intergenic
996508904 5:124297367-124297389 ACCTGTAAGTCCTAGCTACTTGG + Intergenic
997212359 5:132084823-132084845 GCCTGTAGTCCCCAGCTGCTTGG + Intergenic
997324876 5:133012009-133012031 ACCTGTAGTCCCCAGCTACTTGG + Intronic
997462692 5:134064841-134064863 GCCTGTGGGTCCCAGCTACTTGG - Intergenic
997540731 5:134659775-134659797 GCCTGTAAGTCCCAGCTACTTGG - Intronic
997756463 5:136404296-136404318 ACAAGTGGGCCCCAAATACTAGG + Intergenic
997918134 5:137949834-137949856 GCCTGTAAGTCCCAGCTACTTGG + Intronic
997934558 5:138098910-138098932 GCCTGTAGTCCCCAGCTGCTCGG + Intergenic
998038035 5:138933006-138933028 ACCTGTAAGTCCCAGCTACTTGG + Intronic
998217875 5:140251058-140251080 ACCTGTAATCCTCAGCTACTCGG - Intronic
998226184 5:140328261-140328283 ACCTGTAAGTCCCAGCTACTTGG - Intergenic
998438704 5:142137284-142137306 ACCTGCAAGTCCCAGCTACTTGG - Intronic
998440576 5:142158288-142158310 GCCTGTAATCCCCAGCTACTTGG + Intergenic
998530534 5:142880390-142880412 GCCTGTAGTTCCCAGCTACTCGG + Intronic
998829887 5:146146213-146146235 ACCTGTAACGCCCAGCTACTTGG + Intronic
999106488 5:149075513-149075535 ACCCCTGGGCCCAAGCTACTGGG + Intergenic
999403826 5:151288932-151288954 ACCTGTAAATCCCAGCTACTCGG + Exonic
999769446 5:154764182-154764204 GCCTGTAATCCCCAGCTACTCGG + Intronic
1000235885 5:159360144-159360166 GCCTGTAAGTCCCAGCTACTTGG + Intergenic
1000638851 5:163677119-163677141 GCCTGTAGTCCCAAGCTACTTGG + Intergenic
1000677653 5:164141321-164141343 GCCTGGAGTCCCCAGCTACTCGG + Intergenic
1000928815 5:167228152-167228174 ACCTGTAGTCCCCAGCTACCTGG - Intergenic
1001736571 5:174008705-174008727 GCCTGTAAGTCCCAGCTACTCGG + Intergenic
1001743355 5:174071359-174071381 ACCTATAGGTCCCAGCTACTTGG + Intronic
1002384365 5:178855240-178855262 TCCAGGAGGACCCAGGTACTGGG - Intergenic
1002484722 5:179526853-179526875 ACCTGTTGGTCCCAGCTACTCGG - Intergenic
1003604860 6:7550170-7550192 GCCTGTAAGTCCCAGCTACTCGG - Intronic
1004312666 6:14559444-14559466 GCCTGTAAGTCCCAGCTACTCGG + Intergenic
1004405869 6:15333055-15333077 GCCTGTAGTCCCAAGCTACTCGG - Intronic
1004536762 6:16510609-16510631 ACCTGTAGTCCCAAGCTACTTGG + Intronic
1005157465 6:22823223-22823245 ACCTGAAGTCCCAAGCTACTTGG - Intergenic
1005476168 6:26210143-26210165 GCCTGTAGTCCCCAGCTACTCGG + Intergenic
1005523317 6:26620234-26620256 ACCTGTAAGTCCCAGCTACTTGG - Intergenic
1005823789 6:29619613-29619635 ACCTGTAGTCCCCAGCACCTTGG - Intronic
1006232968 6:32600909-32600931 ACCTGTAAGCCCCAGCTATTTGG + Intergenic
1006274082 6:32987447-32987469 ACCTGTAGTCTCCAGCTACTTGG - Intergenic
1006324400 6:33342478-33342500 GCCAGTAAATCCCAGCTACTTGG - Intergenic
1006345281 6:33476070-33476092 ACCTGTAGTCCCCAGCTACTCGG + Intergenic
1006601458 6:35229289-35229311 ACCTGTAGTCCCCAGCTACTTGG + Intronic
1006654677 6:35580662-35580684 ACCTGTAGTCCCCAGCTACTCGG - Intronic
1006676590 6:35768960-35768982 ACCTGTAGTCCCAAGCTACTTGG - Intergenic
1006689903 6:35873950-35873972 ACCTGTAGTCCCAAGCTACTCGG - Intronic
1007123714 6:39406143-39406165 CCCTGTAATCCCCAGCTACTCGG - Intronic
1007331145 6:41110223-41110245 GCCTGTAGTCCCCAGCTACTCGG - Intergenic
1007579319 6:42946986-42947008 GCCTGTAGGTCTCAGCTACTTGG - Intergenic
1007936802 6:45739557-45739579 GCCTGTAGTTCCCAGCTACTTGG + Intergenic
1008213301 6:48752751-48752773 AGCAGTTGGCCCAAGCCACTGGG - Intergenic
1008750874 6:54732264-54732286 ACCTGTAGTCCCCAGCTACTTGG - Intergenic
1009987558 6:70800155-70800177 CTCTGTAGTCCCCAGCTACTTGG + Intronic
1010233092 6:73552876-73552898 GCCAGGGGGTCCCAGCTACTTGG + Intergenic
1010237789 6:73589634-73589656 ACCTGTAGTTCCCAGCTACTCGG - Intergenic
1010253023 6:73727985-73728007 ACCAGGACGCCCTAGGTACTTGG - Intronic
1010434621 6:75814731-75814753 ACCTGATGGTCCCAGCTACTTGG + Intronic
1011284984 6:85713767-85713789 ACCTGTAAGTCCCAGTTACTTGG - Intergenic
1011641631 6:89421150-89421172 TCCTGTAAGTCCCAGCTACTTGG + Intergenic
1011666746 6:89641848-89641870 ACCTGTAATCCCAAGCTACTTGG - Intergenic
1011728979 6:90241007-90241029 GCCTGTAGTCTCCAGCTACTTGG + Intronic
1012886241 6:104849460-104849482 GCCTGTAAGTCCCAGCTACTTGG - Intronic
1013140187 6:107326226-107326248 GCCTGTAAGTCCCAGCTACTCGG - Intronic
1013289189 6:108706182-108706204 ACCTGTAATTCCCAGCTACTTGG - Intergenic
1014423732 6:121275992-121276014 ACCTATAGGTCCCAGCTACTTGG + Intronic
1014629460 6:123771433-123771455 ACCTGTAGGCCCCTGCTTCAAGG + Intergenic
1015033431 6:128624402-128624424 ACCTGTAGAACCCAGCTACTTGG + Intergenic
1015075712 6:129154284-129154306 GCCTGTTGTCCCCAGCTACTCGG + Intronic
1016970525 6:149758006-149758028 GCCTGTAAGTCCCAGCTACTCGG - Intronic
1017042102 6:150315884-150315906 GCCTATAGGTCCCAGCTACTTGG + Intergenic
1017550711 6:155504083-155504105 GCCTGTAAGTCCCAGCTACTTGG + Intergenic
1017841816 6:158228480-158228502 ACCTGTAGTCCCCTGCTACTCGG - Intergenic
1017842136 6:158231205-158231227 ACCTGTAGTCCCTAGCTACTCGG + Intergenic
1018257478 6:161936332-161936354 GCCTGTAGTCCCCAGCTGCTTGG - Intronic
1018480733 6:164186966-164186988 AGCAGCAGGCCCCAGCTCCCAGG - Intergenic
1018997854 6:168724121-168724143 GCCTCTAGGCCCCAGCTACCAGG + Intergenic
1019687979 7:2392436-2392458 GCCTGTAAGTCCCAGCTACTTGG + Intergenic
1019808655 7:3148209-3148231 ACCTGTAATCCCCAGGTACTCGG - Intronic
1019858245 7:3631056-3631078 GCCTGTAGTCCCAAGCTACTTGG - Intronic
1019915955 7:4132600-4132622 ACCTGTTGGTCCCAGCTACTTGG + Intronic
1020032693 7:4944057-4944079 ACCTGTAGTCCCCAGCTACTTGG - Intronic
1020063695 7:5171284-5171306 GCCTGTAACCCCCAGCTACTTGG - Intergenic
1020066922 7:5195358-5195380 GCCTGTGGTCCCCAGCTACTCGG + Intronic
1020273678 7:6612357-6612379 ACCTGTAGTTCCCAGCTACTCGG + Intergenic
1020959967 7:14789677-14789699 ACCTGTAAGTCCCAGCTACTGGG - Intronic
1021431432 7:20562761-20562783 ACAAGCATGCCCCAGCTAGTGGG + Intergenic
1021581710 7:22161081-22161103 GCCTGTAATCCCCAGCTACTCGG + Intronic
1021720337 7:23498795-23498817 GCCTGTAGTCCCGAGCTACTCGG + Intergenic
1021726224 7:23550375-23550397 ACCTGTAAATCCCAGCTACTTGG - Intergenic
1021889692 7:25175381-25175403 ACCTGTAGGTCCCAGCTACTTGG - Intronic
1022069725 7:26900880-26900902 AAAACTAAGCCCCAGCTACTTGG - Intronic
1022135608 7:27445313-27445335 ACCTGGAGTCTCCAGCTACTTGG + Intergenic
1022475818 7:30708867-30708889 CACAGTTGGTCCCAGCTACTTGG - Intronic
1022518321 7:30989439-30989461 ACTAGGAGGCCACAGCGACTGGG - Intronic
1022551096 7:31239312-31239334 ACCTGTAAGTCTCAGCTACTTGG + Intergenic
1023063617 7:36353147-36353169 GCCTGTAAGTCCCAGCTACTGGG + Intronic
1023167931 7:37361834-37361856 ACCTGTAAGTCCCACCTACTTGG + Intronic
1023290236 7:38660493-38660515 GCCTGTGGGTCCCAGCTACTTGG - Intergenic
1023419216 7:39961232-39961254 GCCTGTAGACCCCAACTACTCGG + Intronic
1023433982 7:40123115-40123137 ACGCGTTGGTCCCAGCTACTTGG - Intergenic
1023749691 7:43360335-43360357 ATCTGTAGTTCCCAGCTACTTGG - Intronic
1023801061 7:43835117-43835139 GCCTGTAGTCCCAAGCTACTGGG - Intergenic
1023802601 7:43847966-43847988 ACCTGTGGTCACCAGCTACTTGG + Intergenic
1023915839 7:44588562-44588584 GCCAGTGGTCCCCAGTTACTTGG + Intergenic
1023924728 7:44658959-44658981 ACTGGTAGCCCCCTGCTACTTGG - Intronic
1024164637 7:46718739-46718761 ACCTGTGGTCTCCAGCTACTTGG + Intronic
1024830521 7:53449638-53449660 GCCGGTAGTCCCCAGATACTTGG - Intergenic
1025013256 7:55416409-55416431 GCCTGTAGTCCCCAGCTACTTGG - Intronic
1025039825 7:55631865-55631887 GCCTGTAAGTCCCAGCTACTCGG - Intergenic
1025071592 7:55904335-55904357 ACCTGTAATTCCCAGCTACTTGG + Intronic
1025184829 7:56849639-56849661 ACCTGTAAATCCCAGCTACTTGG + Intergenic
1025687102 7:63727325-63727347 ACCTGTAAATCCCAGCTACTTGG - Intergenic
1025733472 7:64126797-64126819 ACCTGTAGTCCCCAGCTACTCGG + Intronic
1026167633 7:67924326-67924348 GCCTGTAGGTCCCAGCTGCTTGG + Intergenic
1026189544 7:68112277-68112299 GCCTGTAGTTCCCAGCTACTTGG - Intergenic
1026580142 7:71608902-71608924 ACCTATAGTCCCCAGCTACTTGG - Intronic
1026797048 7:73372912-73372934 GCCTGTAGTCCCAAGCTACTTGG + Intergenic
1026859288 7:73774767-73774789 ACCTGTAGTTCCCAGCTACTTGG + Intergenic
1026928799 7:74211400-74211422 GCCTGTAGTCCCCAGCTACTTGG - Intronic
1027025398 7:74848230-74848252 ACCTGTAACCCCCAGCTACTTGG - Intronic
1027058617 7:75067681-75067703 GCCTGTTGGTCCCAGCTACTTGG + Intronic
1027062365 7:75095889-75095911 ACCTGTAACCCCCAGCTACTTGG + Intronic
1027246381 7:76370432-76370454 GCTTGTAGTCCCCAGCTACTCGG - Intergenic
1027406195 7:77863899-77863921 TCCTGTAGTCCCCAGCTACTTGG - Intronic
1028403423 7:90448928-90448950 ATCTATAGTCCCCAGCTACTCGG - Intronic
1028596990 7:92556181-92556203 GTCTGTAGGCCCAAGCTACTTGG + Intergenic
1028729661 7:94131173-94131195 GCCTGTAGTCCCCAGCTACTTGG + Intergenic
1029049935 7:97675148-97675170 ACCTGTGGGTCCCAGCTACTTGG + Intergenic
1029402769 7:100356036-100356058 ACCTGTAATTCCCAGCTACTTGG + Intronic
1029419073 7:100462976-100462998 GTCTGTAGTCCCCAGCTACTCGG + Intronic
1029645239 7:101850981-101851003 ACCTGTAAGTCCCAGCTACATGG + Intronic
1029983872 7:104903588-104903610 ACCTGTAGTCTCAAGCTACTTGG - Intronic
1030071890 7:105705148-105705170 ACCTGTAAATCCCAGCTACTTGG - Intronic
1030626543 7:111851317-111851339 GCCTGTAAGTCCCAGCTACTAGG + Intronic
1031942004 7:127798919-127798941 ACCTATAGTCCCCAGCTACTCGG + Intronic
1032043623 7:128583629-128583651 GTCTGTAGTCCCCAGCTACTCGG - Intergenic
1032065433 7:128766080-128766102 ACCTGTAATCTCCAGCTACTGGG - Intronic
1032485058 7:132279507-132279529 ACCTGTAGTTCTCAGCTACTTGG + Intronic
1032485363 7:132283002-132283024 GCCTGTAGGTCCCAGTTACTTGG - Intronic
1033113496 7:138604550-138604572 ACCTGTAAATCCCAGCTACTTGG + Intronic
1033180527 7:139173351-139173373 GCCTGTAATCCCCAGCTACTCGG - Intronic
1033313323 7:140278347-140278369 GCCTGTAGTCCCCAGCTACTTGG - Intergenic
1033379758 7:140804008-140804030 GCCTGTAGTCCCCAGCTACTTGG - Intronic
1034147649 7:148886202-148886224 ACCTGTGGTCCCCAGCTACTCGG - Intergenic
1034532017 7:151701715-151701737 ACCTGTAGTCCCCAGCTACTCGG + Intronic
1035863534 8:3056491-3056513 GCCTGTAGTCCCCAGCTACTGGG - Intronic
1036424394 8:8630217-8630239 ATCTGTAGTCCCCAGCTACTCGG + Intergenic
1037598947 8:20377670-20377692 GCCTGTAGTCCCTAGCTACTTGG + Intergenic
1037848880 8:22309461-22309483 GCCTGTAGTCCCCAGCTACTTGG - Intronic
1038111459 8:24504239-24504261 ACCTGTAGTCCCTAGCTACACGG + Intronic
1038557286 8:28532550-28532572 GCCTGTAAGCCCCACCTACTTGG - Intronic
1038578775 8:28728760-28728782 GCCTGTAGGTCCCAGCTACTTGG + Intronic
1038759128 8:30370210-30370232 GCCTGTAGTCCCCAGCTACTTGG - Intergenic
1038798361 8:30728385-30728407 ACCTGTAGTTCCCAGCTACCGGG - Intergenic
1038898866 8:31819111-31819133 ACCTGTAGTCCCCAGCTACTTGG + Intronic
1039206887 8:35166151-35166173 ATCTGTAAGTCCCAGCTACTGGG - Intergenic
1039538983 8:38345781-38345803 GCCTGTAGTCCCCAGCTACTCGG + Intronic
1039564880 8:38544228-38544250 GCCTGTAGGTCCCAGCTACTTGG + Intergenic
1039566930 8:38558526-38558548 ACCTGTAGTCCCAAGCTACTCGG + Intergenic
1039873469 8:41566705-41566727 CTCAGTAGGTCCCAGCTACTCGG - Intergenic
1039964352 8:42272812-42272834 GCCTGTAGTCCCCAGCTACTTGG + Intronic
1040493721 8:47947953-47947975 ACCTATAGTCCCCAGCTACTTGG + Intronic
1040591056 8:48792428-48792450 ACCAGCAAGCCCCTGCTGCTTGG - Intergenic
1040775438 8:51037648-51037670 GCCTGTAGTCCCAAGCTACTCGG - Intergenic
1041058100 8:54008522-54008544 TCCTGTAGTCCCCAGTTACTTGG + Intronic
1041256961 8:55987280-55987302 GCGAGTAGGTCCCAGCTACTGGG + Intronic
1041617390 8:59923525-59923547 ACAAGTAGGCGCAAGCTATTGGG + Intergenic
1041700890 8:60787944-60787966 GCCTGTAGACCCAAGCTACTAGG - Intronic
1042293367 8:67193221-67193243 GCCTGTAGTCCCCGGCTACTTGG - Intronic
1042754050 8:72190163-72190185 ACCTGTAGTCCCAAGCTACTCGG + Intergenic
1043689163 8:83128946-83128968 ACCTGTGGGCCCCAGCTATTTGG + Intergenic
1043795051 8:84526075-84526097 ACCTGTAAATCCCAGCTACTCGG - Intronic
1044692045 8:94890716-94890738 ACCTGTAACTCCCAGCTACTTGG - Intronic
1044781039 8:95743781-95743803 ACCTGTAATTCCCAGCTACTTGG + Intergenic
1045228316 8:100273905-100273927 GCCTGTAATCCCCAGCTACTCGG - Intronic
1045755625 8:105537854-105537876 ACCTGTAAGTCCCAGCTACTAGG - Intronic
1046273582 8:111927414-111927436 ACCACTATGCCTGAGCTACTCGG - Intergenic
1046495301 8:115006270-115006292 GCCTGTAGTCCGCAGCTACTCGG - Intergenic
1046629114 8:116605879-116605901 ACCTGTAATCCCCAGCTACTCGG - Intergenic
1046790464 8:118316408-118316430 GCCTGTAAGTCCCAGCTACTTGG + Intronic
1047001706 8:120579552-120579574 CCCTGTAGCCCCCAGCTACTCGG + Intronic
1047254667 8:123206527-123206549 ACGAGAAGGCCCCGGCTGCTGGG + Intronic
1047656165 8:126979733-126979755 GCCTGTAAGTCCCAGCTACTCGG - Intergenic
1047955874 8:129975003-129975025 GCCTGTAGTCCCAAGCTACTCGG - Intronic
1047972959 8:130101688-130101710 GCCTGTAGTCCCCAGCTAGTAGG - Intronic
1048899287 8:139022294-139022316 ACCAGTGGCCCCCTGCTGCTCGG - Intergenic
1049080260 8:140437496-140437518 GCCTGTAAGTCCCAGCTACTCGG + Intronic
1049938412 9:521690-521712 ACCTGTAATCCCCAGCTACTCGG - Intronic
1050107074 9:2176675-2176697 GCCTGTAGTCCCAAGCTACTTGG - Intronic
1051269418 9:15340873-15340895 GCCTGTAGTCCCAAGCTACTTGG - Intergenic
1051583105 9:18698407-18698429 ACCTGCAAGCCCAAGCTACTTGG - Intronic
1051645465 9:19263778-19263800 GCCTGTAGTCCCCAGCTACTCGG - Intronic
1051756236 9:20403942-20403964 ACCTGTAGTCCCAAGCTACTTGG - Intronic
1052809741 9:33046766-33046788 ACCTGTAGTCCCCAGCTACTCGG + Exonic
1052959805 9:34285826-34285848 GCCTGCAGTCCCCAGCTACTTGG + Intronic
1053143347 9:35695714-35695736 ACCTGTAATTCCCAGCTACTTGG - Intergenic
1053191088 9:36069413-36069435 ACCTGTAAATCCCAGCTACTCGG + Intronic
1054767220 9:69052277-69052299 GCCTGTAGTTCCCAGCTACTTGG - Intronic
1054790260 9:69250226-69250248 ACCTCTAAGTCCCAGCTACTCGG - Intronic
1055015975 9:71618593-71618615 GCCTGTAGTCCCCAGCTACTTGG - Intergenic
1055419576 9:76124618-76124640 GCCTGTAGAACCCAGCTACTCGG + Intronic
1055618764 9:78101105-78101127 GCCTGTAGTGCCCAGCTACTCGG + Intergenic
1056142607 9:83697859-83697881 GCCTGTAATCCCCAGCTACTCGG - Intronic
1056150028 9:83776568-83776590 ATCTGTAGACCCCAGCTACTCGG + Intronic
1056338193 9:85598843-85598865 GCCTGTAGTCCCCAGCTACTCGG - Intronic
1057421497 9:94916576-94916598 ACCTGTAGTCCCAAGCTACTCGG + Intronic
1057705722 9:97393611-97393633 ACCAGGAAGCCCCAACTCCTTGG + Intergenic
1057782088 9:98058046-98058068 GCCTGTGGGTCCCAGCTACTCGG - Intronic
1057803604 9:98205015-98205037 ACCAGTAGGAAGCAGCTACCTGG - Intronic
1058193814 9:101950769-101950791 TCCTGTAGTCCCCAGCTACAAGG - Intergenic
1058362943 9:104171653-104171675 ACCTGTAGTACCCAGCTACTCGG + Intergenic
1059783425 9:117553799-117553821 ACCTGTTGTCCCCAGCTACTTGG + Intergenic
1060360278 9:122949386-122949408 ACCTGTAATTCCCAGCTACTTGG + Intronic
1060499253 9:124140423-124140445 ACCTGTAAGTCCCAGCTACTTGG - Intergenic
1060620225 9:125058387-125058409 GCCTGCAGTCCCCAGCTACTAGG + Intronic
1060660852 9:125404418-125404440 ACCTGTAAATCCCAGCTACTTGG - Intergenic
1060761109 9:126249551-126249573 ACCTATTGGTCCCAGCTACTTGG - Intergenic
1060964365 9:127704381-127704403 GCGTGTAGTCCCCAGCTACTCGG + Intronic
1061292925 9:129662463-129662485 GCCTATAGTCCCCAGCTACTTGG - Intergenic
1061343612 9:130003796-130003818 GCCTGTAGTCCCCAGCTACTCGG + Intronic
1061606619 9:131715737-131715759 ACCTGTACTCCCAAGCTACTCGG + Intronic
1185501910 X:603323-603345 ACCTGTAACCCCCAGCTACTCGG + Intergenic
1185871185 X:3666278-3666300 GCCTGTAGTCCTCAGCTACTTGG - Intronic
1186038548 X:5450743-5450765 ACCCGTAGTCCCAAGCTACTAGG - Intergenic
1186059148 X:5684994-5685016 ACCTGTAGTCCCAAGCTATTTGG - Intergenic
1187057727 X:15756927-15756949 ACCTGTAAGTCCCAGCTACTCGG + Intronic
1187159995 X:16755415-16755437 GCCTGTAAGTCCCAGCTACTTGG - Intronic
1187193642 X:17060175-17060197 ACCTGTGGTCCCCAGCTACTCGG + Intronic
1187195888 X:17083207-17083229 GCCTGTAGTCCCCAGCTATTTGG - Intronic
1187342010 X:18429758-18429780 GCCTGTAGTCTCCAGCTACTAGG - Intronic
1187342434 X:18433101-18433123 ACCTGTAGGCCCAACCTCCTGGG + Intronic
1187482341 X:19669086-19669108 ACCTGTAGTCCCCAGCTACTCGG - Intronic
1187924771 X:24239643-24239665 GCCTATAGTCCCCAGCTACTCGG - Intergenic
1187992346 X:24888698-24888720 GCCTGTAGTCCCAAGCTACTCGG - Intronic
1188100330 X:26074485-26074507 ACCTGTATTCCCAAGCTACTTGG - Intergenic
1189233347 X:39469356-39469378 CCCAGCAGGCCCCAGCCACCAGG + Intergenic
1189436129 X:40994329-40994351 ACCTGTAGTCCCCAGCTACTTGG - Intergenic
1189747799 X:44188094-44188116 ACCTGCAGTCCCCAGATACTCGG - Intronic
1189823452 X:44893047-44893069 GCCTGTAAGTCCCAGCTACTTGG + Intronic
1189911701 X:45816609-45816631 TCCTGTAGTCCCCAGCTATTTGG + Intergenic
1189913664 X:45836267-45836289 GCCCATAGTCCCCAGCTACTCGG + Intergenic
1190689836 X:52904422-52904444 ACCTGTAGTCCCCAGCTACTGGG - Intronic
1190696147 X:52951370-52951392 ACCTGTAGTCCCCAGCTACTGGG + Intronic
1190790289 X:53693655-53693677 GCCTGTAAGTCCCAGCTACTGGG - Intergenic
1190867120 X:54394130-54394152 GCCTGTAGTCCCCAGCTACTTGG + Intergenic
1192426021 X:71077310-71077332 GCCTGTAGTCCCCAGCTACTTGG + Intergenic
1192523928 X:71825193-71825215 GCCTGTAGTCCCCAGCTACTTGG - Intergenic
1192603199 X:72486549-72486571 GCCTGTTTGCCCCAGCTACTTGG + Intronic
1193121590 X:77828439-77828461 ACCTGTAAATCCCAGCTACTTGG + Exonic
1195387392 X:104326023-104326045 ACCTGTAATCCCCAGCTACTCGG - Intergenic
1195953413 X:110302746-110302768 ACCTGTAATCCCCAGCTACTTGG + Intronic
1196729749 X:118928933-118928955 GCCTGTAAGTCCCAGCTACTTGG - Intergenic
1196803088 X:119561111-119561133 ACCAGCCTGGCCCAGCTACTTGG + Intronic
1196853340 X:119960080-119960102 GCCTGTAGACCCTAGCTACTCGG - Intergenic
1197037803 X:121897981-121898003 ACCTGTAGTCCCCAGCTACTGGG - Intergenic
1198180361 X:134201798-134201820 ACCTGTAAATCCCAGCTACTTGG + Intergenic
1198207169 X:134477797-134477819 ACCTGTTAGTCCCAGCTACTCGG - Intronic
1198382306 X:136095441-136095463 GCCTGTAAGTCCCAGCTACTCGG + Intergenic
1198531699 X:137554539-137554561 GCCTGTAGTCTCCAGCTACTTGG + Intergenic
1198753328 X:139957039-139957061 ACCTGTAGTCCCCAGCTACTTGG + Intronic
1198783644 X:140263568-140263590 ACCTGTAAACCCCAGCTACTTGG - Intergenic
1198894512 X:141437991-141438013 ACCTGTGGTCCCAAGCTACTTGG - Intergenic
1199743165 X:150754898-150754920 GCCTGTAGTCCCCAGCTACTCGG + Intronic
1200792845 Y:7314865-7314887 ACCTGTAAGTCCCAGCTACTTGG - Intergenic
1201677007 Y:16597249-16597271 ACCTGTAAGTCCCAGCTACTCGG + Intergenic
1201980645 Y:19906045-19906067 GCCTGTAAGCCCCAACTACTAGG - Intergenic