ID: 968640597

View in Genome Browser
Species Human (GRCh38)
Location 4:1712574-1712596
Sequence ACCCGCGGGATTGAGGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968640588_968640597 -2 Left 968640588 4:1712553-1712575 CCTGAGGAAAAGGTTGCCCCCAC 0: 1
1: 0
2: 2
3: 11
4: 115
Right 968640597 4:1712574-1712596 ACCCGCGGGATTGAGGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 68
968640582_968640597 27 Left 968640582 4:1712524-1712546 CCAGATGGACGCCGTGGGCTGAG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 968640597 4:1712574-1712596 ACCCGCGGGATTGAGGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 68
968640585_968640597 16 Left 968640585 4:1712535-1712557 CCGTGGGCTGAGGAGAGGCCTGA 0: 1
1: 0
2: 4
3: 31
4: 402
Right 968640597 4:1712574-1712596 ACCCGCGGGATTGAGGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968640597 Original CRISPR ACCCGCGGGATTGAGGCGGC CGG Intergenic
901666170 1:10827578-10827600 CCCCGAGGGAGCGAGGCGGCGGG + Intergenic
905066921 1:35192333-35192355 AGCCGCCGCATCGAGGCGGCGGG - Exonic
912568608 1:110606442-110606464 GCCGGCGGGATTGGGTCGGCAGG - Intronic
913520976 1:119646103-119646125 ACCGGCTGGATTGATGCGGCTGG - Intronic
917869514 1:179229334-179229356 TCCCGCGGGGCTGAGGCTGCTGG + Exonic
919734124 1:200934740-200934762 ACTCACGGGATGGAGGCTGCAGG + Intergenic
919892687 1:201987220-201987242 ACACGCAGGATTGAGATGGCTGG - Intronic
922731677 1:227951834-227951856 ACCCGCTGGATGGAGGGGACTGG + Intergenic
1064616912 10:17168224-17168246 ACCTGGGAGATTGAGGCTGCAGG + Intronic
1083834735 11:65258633-65258655 ACCCAGGAGATTGAGGCTGCAGG + Intergenic
1083992889 11:66257774-66257796 GCCGGCGGGATGGAGGCGGCGGG + Intronic
1085205793 11:74731274-74731296 GCGCGCGGGCTAGAGGCGGCCGG + Intronic
1089799569 11:121014287-121014309 ACTTGGGGGATTGAGGCGGGAGG + Intergenic
1095476256 12:42589840-42589862 CGCCGCGGGATCGAGGCCGCTGG + Intronic
1102534389 12:113569877-113569899 CCCGGCGGGATGGAGGAGGCCGG + Intergenic
1104898472 12:132175636-132175658 ACCCGCGGGACTGTGGCATCTGG + Intergenic
1105759859 13:23503766-23503788 ACCCAGGAGGTTGAGGCGGCAGG - Intergenic
1106243267 13:27926727-27926749 ACCCGCAGCACTGAGGCGTCAGG - Intergenic
1107502840 13:40998036-40998058 ACCCGTGAGGTTGAGGCGGGAGG + Intronic
1108522630 13:51259520-51259542 ACCTGCGGGGGTGAGGCAGCCGG - Intronic
1112260083 13:97869708-97869730 GCCCCCGGGTTTGAGGGGGCTGG + Intergenic
1123664831 15:22599863-22599885 ACCCGGGAGATGGAGGCCGCAGG - Intergenic
1128170769 15:65510205-65510227 ACTTGGGGGATTGAGGCGGGAGG + Intronic
1132582945 16:693804-693826 CCCAGTGGGATTGAGGGGGCTGG - Exonic
1134508134 16:14824483-14824505 ACCCGCTGCAGTGAGGGGGCCGG + Intronic
1134695832 16:16223248-16223270 ACCCGCTGCAGTGAGGGGGCCGG + Intronic
1134975994 16:18571440-18571462 ACCCGCTGCAGTGAGGGGGCCGG - Intergenic
1141573368 16:84948160-84948182 CCCCGGGGGACTGAGGTGGCAGG + Intergenic
1146201183 17:30860098-30860120 ACCCGGGAGATCGAGGCTGCAGG - Intronic
1162056689 19:8068591-8068613 ACTTGGGGGATTGAGGCGGGAGG + Intronic
1162844533 19:13382168-13382190 ACCCCAGGGATAGAGGAGGCAGG + Intronic
1165353526 19:35290532-35290554 ACCTGTGGGAGCGAGGCGGCTGG - Intergenic
1165405673 19:35629394-35629416 ACCTTCGGGATTGTGGGGGCGGG + Intronic
1165685676 19:37817664-37817686 ACCCCCGGGCCTGAGGAGGCGGG - Intergenic
1165867263 19:38946377-38946399 ACCCGTGGGGTTGATGGGGCGGG + Intronic
1166890798 19:45991600-45991622 ACTCGCGGGGTTGAGGCAGGAGG + Intergenic
1167413707 19:49359975-49359997 ACCGGCGGCAGTGAGGGGGCTGG - Exonic
927964904 2:27262597-27262619 ACCCGAGGAAGTCAGGCGGCCGG + Intronic
935566274 2:104610901-104610923 GCCCGGGAGATTGAGGCTGCAGG + Intergenic
937351474 2:121166418-121166440 ACCTGGGGGATCGAGGCTGCAGG - Intergenic
941804319 2:169694720-169694742 ACCCTCGGGGTGGAGCCGGCAGG + Exonic
946255148 2:218436657-218436679 GCCCTGGGGATTGAGGTGGCTGG - Intronic
947117916 2:226791586-226791608 ACCCGCGGGAAAGAGGTGCCAGG + Intronic
947622240 2:231598098-231598120 ACCAGCTGGATTGAGGGGCCAGG + Intergenic
1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG + Intronic
1176217702 20:63956083-63956105 CCCCGCGGGCTTGAAGCGGCCGG - Intronic
1183942280 22:41302358-41302380 GCCCGCGGGAAGGGGGCGGCAGG + Intronic
956080252 3:65549476-65549498 ACGCGCGGGGATGAGGCGGGCGG - Intronic
962237316 3:133717697-133717719 ACCACATGGATTGAGGCGGCTGG + Intergenic
966810708 3:183841916-183841938 ACCCAGGAGATTGAGGCAGCCGG + Intronic
968640597 4:1712574-1712596 ACCCGCGGGATTGAGGCGGCCGG + Intergenic
968930672 4:3576979-3577001 GCCCTCTGGATTGAGGCAGCAGG + Exonic
969876478 4:10139353-10139375 ACCCCCAGGATTGACGAGGCCGG - Intergenic
981616346 4:146648206-146648228 GCCAGCGGGAGGGAGGCGGCGGG + Intergenic
997279750 5:132633179-132633201 ACCCGGGAGATGGAGGCGGAAGG - Intronic
1001401936 5:171451068-171451090 GCCCGCGGGCGGGAGGCGGCCGG - Intronic
1010953465 6:82064050-82064072 ACCCTTGGGAATGAGGAGGCAGG + Intergenic
1026905896 7:74062625-74062647 ACCCGGGAGATGGAGGCTGCAGG - Intronic
1032496551 7:132367419-132367441 ACACTCGGGAGTGAGGTGGCAGG + Intronic
1034195719 7:149245580-149245602 GCCCAGGGGATTGAGGCTGCAGG - Intronic
1035277729 7:157758086-157758108 ACGCGCGGGATTGACGGAGCGGG + Intronic
1035854750 8:2962969-2962991 GCCCGAGAGATTGAGGCTGCAGG + Intronic
1039868890 8:41529061-41529083 ACCCAAGGACTTGAGGCGGCGGG - Intergenic
1045765423 8:105662116-105662138 ACACGCGTGATGGAGGAGGCAGG + Intronic
1049093012 8:140530902-140530924 ACACACGGGGATGAGGCGGCAGG + Intergenic
1049309681 8:141927078-141927100 ACCCCTTGGATTGAGGTGGCTGG - Intergenic
1049575092 8:143386212-143386234 AACTGCTGGCTTGAGGCGGCGGG - Intergenic
1054459446 9:65454935-65454957 GCCCTCTGGATTGAGGCAGCAGG - Intergenic
1057766394 9:97922955-97922977 ACCCAGGAGATTGAGGCGGGAGG + Intergenic
1203486099 Un_GL000224v1:56673-56695 ACCCACGAGGTTGAGGCTGCAGG - Intergenic
1190897401 X:54634376-54634398 ACCCGGGAGATGGAGGTGGCAGG - Intergenic
1196459787 X:115918269-115918291 ACCCTAGGAATTGAGGGGGCTGG - Intergenic