ID: 968640604

View in Genome Browser
Species Human (GRCh38)
Location 4:1712598-1712620
Sequence AGCGTCGCAGAGGCCCGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 73}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968640604_968640617 16 Left 968640604 4:1712598-1712620 CCGCCGCGGGCCTCTGCGACGCT 0: 1
1: 0
2: 1
3: 14
4: 73
Right 968640617 4:1712637-1712659 GCGGGCGGGGGCAGCTTTGGCGG 0: 1
1: 0
2: 2
3: 31
4: 318
968640604_968640610 -2 Left 968640604 4:1712598-1712620 CCGCCGCGGGCCTCTGCGACGCT 0: 1
1: 0
2: 1
3: 14
4: 73
Right 968640610 4:1712619-1712641 CTGATAGGTCGCGCCTTGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 22
968640604_968640619 25 Left 968640604 4:1712598-1712620 CCGCCGCGGGCCTCTGCGACGCT 0: 1
1: 0
2: 1
3: 14
4: 73
Right 968640619 4:1712646-1712668 GGCAGCTTTGGCGGGAGATTCGG 0: 1
1: 0
2: 0
3: 9
4: 160
968640604_968640618 17 Left 968640604 4:1712598-1712620 CCGCCGCGGGCCTCTGCGACGCT 0: 1
1: 0
2: 1
3: 14
4: 73
Right 968640618 4:1712638-1712660 CGGGCGGGGGCAGCTTTGGCGGG 0: 1
1: 0
2: 1
3: 26
4: 202
968640604_968640608 -6 Left 968640604 4:1712598-1712620 CCGCCGCGGGCCTCTGCGACGCT 0: 1
1: 0
2: 1
3: 14
4: 73
Right 968640608 4:1712615-1712637 GACGCTGATAGGTCGCGCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 10
968640604_968640609 -3 Left 968640604 4:1712598-1712620 CCGCCGCGGGCCTCTGCGACGCT 0: 1
1: 0
2: 1
3: 14
4: 73
Right 968640609 4:1712618-1712640 GCTGATAGGTCGCGCCTTGGCGG 0: 1
1: 0
2: 0
3: 2
4: 13
968640604_968640611 1 Left 968640604 4:1712598-1712620 CCGCCGCGGGCCTCTGCGACGCT 0: 1
1: 0
2: 1
3: 14
4: 73
Right 968640611 4:1712622-1712644 ATAGGTCGCGCCTTGGCGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 14
968640604_968640612 2 Left 968640604 4:1712598-1712620 CCGCCGCGGGCCTCTGCGACGCT 0: 1
1: 0
2: 1
3: 14
4: 73
Right 968640612 4:1712623-1712645 TAGGTCGCGCCTTGGCGGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 27
968640604_968640616 13 Left 968640604 4:1712598-1712620 CCGCCGCGGGCCTCTGCGACGCT 0: 1
1: 0
2: 1
3: 14
4: 73
Right 968640616 4:1712634-1712656 TTGGCGGGCGGGGGCAGCTTTGG 0: 1
1: 0
2: 1
3: 13
4: 141
968640604_968640613 3 Left 968640604 4:1712598-1712620 CCGCCGCGGGCCTCTGCGACGCT 0: 1
1: 0
2: 1
3: 14
4: 73
Right 968640613 4:1712624-1712646 AGGTCGCGCCTTGGCGGGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 52
968640604_968640614 4 Left 968640604 4:1712598-1712620 CCGCCGCGGGCCTCTGCGACGCT 0: 1
1: 0
2: 1
3: 14
4: 73
Right 968640614 4:1712625-1712647 GGTCGCGCCTTGGCGGGCGGGGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968640604 Original CRISPR AGCGTCGCAGAGGCCCGCGG CGG (reversed) Intergenic