ID: 968642043

View in Genome Browser
Species Human (GRCh38)
Location 4:1719862-1719884
Sequence GTTTGAGGATGCAGCTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968642043_968642055 26 Left 968642043 4:1719862-1719884 CCCAGGCAGCTGCATCCTCAAAC 0: 1
1: 0
2: 1
3: 17
4: 280
Right 968642055 4:1719911-1719933 TATCCCCAGAGTGGCAAACCTGG 0: 1
1: 0
2: 2
3: 7
4: 108
968642043_968642047 -10 Left 968642043 4:1719862-1719884 CCCAGGCAGCTGCATCCTCAAAC 0: 1
1: 0
2: 1
3: 17
4: 280
Right 968642047 4:1719875-1719897 ATCCTCAAACCAGGATGTGGAGG No data
968642043_968642048 -9 Left 968642043 4:1719862-1719884 CCCAGGCAGCTGCATCCTCAAAC 0: 1
1: 0
2: 1
3: 17
4: 280
Right 968642048 4:1719876-1719898 TCCTCAAACCAGGATGTGGAGGG 0: 1
1: 0
2: 3
3: 18
4: 212
968642043_968642052 17 Left 968642043 4:1719862-1719884 CCCAGGCAGCTGCATCCTCAAAC 0: 1
1: 0
2: 1
3: 17
4: 280
Right 968642052 4:1719902-1719924 CCCCTCTTGTATCCCCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968642043 Original CRISPR GTTTGAGGATGCAGCTGCCT GGG (reversed) Intronic
901374272 1:8826334-8826356 CTTTGGGGAAGCAGCTCCCTGGG - Intergenic
902249690 1:15146175-15146197 GATGGCAGATGCAGCTGCCTAGG + Intergenic
902443191 1:16444692-16444714 GTTTGGAGAGGCAGCTGCCATGG + Intronic
904494969 1:30881435-30881457 GTCAGAGGATGCACCTGCCGAGG - Intronic
904782481 1:32961308-32961330 TATTGAGGATGCTGCTGCTTGGG - Intronic
905061477 1:35143326-35143348 GTTTGGGGGTGCACCTGACTCGG + Intergenic
906360148 1:45149193-45149215 GTTTGAGGCTGCAGTGGGCTAGG + Intronic
910428005 1:87134735-87134757 GTTTCAGGAGCCAGCAGCCTCGG + Intronic
917450197 1:175141660-175141682 CTTTGAAGGTTCAGCTGCCTGGG + Intronic
918619826 1:186590288-186590310 GTTAGAGCATGCAGCAGCCCAGG + Intergenic
920705667 1:208248743-208248765 GTTTGGGACTGCAGTTGCCTGGG - Intergenic
922100734 1:222475357-222475379 TTGTGAGGCAGCAGCTGCCTGGG + Intergenic
922733890 1:227969318-227969340 TTGTGAGGCAGCAGCTGCCTGGG - Intergenic
924262370 1:242245475-242245497 GTGTGGGGATGCAGCGGCGTAGG + Intronic
1064855446 10:19762103-19762125 GTATGATCATGCAGCTGCTTTGG - Intronic
1065322619 10:24523251-24523273 GTTTGAGGCTGCAGTGGGCTAGG + Intronic
1065636966 10:27743352-27743374 GTTTGAGGACGGAGGCGCCTCGG - Exonic
1065880834 10:30036566-30036588 GTGCCAGGCTGCAGCTGCCTGGG - Intronic
1068644513 10:59450856-59450878 GTTTGCTGATGTAGCTGCCAAGG + Intergenic
1071888667 10:89978583-89978605 ATTTGAAGATGCAGCCGCCCAGG - Intergenic
1072631442 10:97149572-97149594 GTTTGATGATGCAGATTCTTGGG + Intronic
1073414535 10:103369709-103369731 TTTGGAGGATGCAGGTTCCTGGG + Intronic
1074916536 10:117961479-117961501 GTGTGGGGATCCAGCTACCTGGG + Intergenic
1077062577 11:624383-624405 ATTTCGGGATGAAGCTGCCTGGG - Intronic
1077182294 11:1222238-1222260 GGTTGAGGAAGCAGCTGCTCCGG - Intergenic
1077332076 11:1988211-1988233 CTGTGGGGCTGCAGCTGCCTTGG - Intergenic
1077819691 11:5724884-5724906 GTTTAAGGCTAGAGCTGCCTAGG - Intronic
1078328900 11:10402494-10402516 ACTTGAGGTTGCTGCTGCCTTGG + Intronic
1079508480 11:21182634-21182656 TTTTCAGGAAGCAGCTACCTAGG + Intronic
1081740726 11:45438013-45438035 GTGTTAGGATGCAGATTCCTGGG - Intergenic
1082014129 11:47471662-47471684 GTTTGAGTCTCCAGCTGCCAGGG + Intronic
1083337636 11:61934210-61934232 GTTTGAGGATGCAGTGAGCTAGG - Intergenic
1083744759 11:64729233-64729255 TTTTGATGACGCAGCTGCCCAGG - Intronic
1087647842 11:100828754-100828776 GTTTGAGGCTGCAGCGAGCTAGG - Intronic
1087647917 11:100829289-100829311 GTTTGAGGCTGCAGCGAGCTAGG + Intronic
1089064709 11:115653728-115653750 ACCTGAGGATGCTGCTGCCTAGG + Intergenic
1090356065 11:126141039-126141061 GTTTGAGGCTGCAGCCCCTTAGG - Intergenic
1202815057 11_KI270721v1_random:43387-43409 CTGTGGGGCTGCAGCTGCCTTGG - Intergenic
1091670231 12:2447280-2447302 GTTTAGGGAGGCAGCTGCCTTGG - Intronic
1092807966 12:12244542-12244564 CTTGGAGGATGCAGCTGCGGTGG - Exonic
1094049133 12:26199519-26199541 TTTTGAGGATGCACTTGGCTGGG + Intronic
1096281102 12:50254642-50254664 GCTTGAGGAAGCAGATACCTGGG - Intronic
1096767411 12:53904099-53904121 GTAACATGATGCAGCTGCCTTGG + Intergenic
1097923708 12:65105222-65105244 GTTTGTTTATGCAGCTGCCTAGG + Intronic
1099260013 12:80367043-80367065 GTTTGAGGCTGCAGTGGGCTAGG - Intronic
1099411566 12:82335549-82335571 GTTTGAGGCTGCAGCAAGCTAGG - Intronic
1101725805 12:107387276-107387298 GATTTAGAATGCAGCTGACTTGG - Intronic
1101905547 12:108822513-108822535 GTTTGAGGCTGCAGCAAGCTAGG - Intronic
1102228009 12:111242786-111242808 GTTGATGGATGCAGCTGCCCCGG - Intronic
1102350780 12:112190659-112190681 GAAGGAGGCTGCAGCTGCCTGGG + Intronic
1104068486 12:125325312-125325334 GTTTGAGGCTGCTGCTCCCATGG - Intronic
1104195092 12:126529295-126529317 GTTTCAGGTTGCAGCAGTCTGGG + Intergenic
1104551564 12:129761792-129761814 ATTTGTGGAGGCAGCTTCCTAGG - Intronic
1106418893 13:29569273-29569295 TTTTGAGGCTGCACCTGGCTTGG - Intronic
1107254444 13:38406891-38406913 ATTTGAAGATGCAGTTGCATAGG + Intergenic
1109168895 13:59071627-59071649 GCTTGGGGGAGCAGCTGCCTGGG - Intergenic
1110341550 13:74397675-74397697 GACTGAGGCTGCAGCAGCCTGGG - Intergenic
1113135571 13:107085229-107085251 GTTTGAAGAAGCAAATGCCTTGG - Intergenic
1113236236 13:108278343-108278365 GTTTGAAGATGGAGCAGACTTGG + Intronic
1115591926 14:34873964-34873986 GTCTGACGTTGGAGCTGCCTGGG - Intronic
1118894746 14:69936356-69936378 TGGTGAGGATGCAGTTGCCTGGG + Intronic
1121528095 14:94633409-94633431 GTTGGAGCAAGCAGCTTCCTGGG + Intergenic
1122124036 14:99569621-99569643 GTTTGAGGCTGGATGTGCCTGGG - Intronic
1202912527 14_GL000194v1_random:132504-132526 GTTTCATGATACTGCTGCCTAGG - Intergenic
1123463393 15:20494876-20494898 GACTGAGGAAGCAGCAGCCTGGG + Intergenic
1123654667 15:22505538-22505560 GACTGAGGAAGCAGCAGCCTGGG - Intergenic
1124052923 15:26215627-26215649 GGATTAGGATGCAGATGCCTTGG - Intergenic
1124274236 15:28312284-28312306 GACTGAGGAAGCAGCAGCCTGGG + Intronic
1124308577 15:28600737-28600759 GACTGAGGAAGCAGCAGCCTGGG - Intergenic
1126603729 15:50454847-50454869 GTTTGAGGATGCAGTGAGCTGGG - Intronic
1128128490 15:65210319-65210341 GCTGGAGGGTGCAGATGCCTCGG + Intronic
1131444921 15:92490686-92490708 GTTAGAGGAGGCATCTGCCATGG - Intronic
1132682910 16:1150988-1151010 GTTGGAGGGTGGAGGTGCCTTGG - Intergenic
1133090113 16:3397513-3397535 GTTTGAGGATGGGTGTGCCTCGG + Exonic
1134463032 16:14446310-14446332 ATTTGATGAAGCAGATGCCTGGG - Intronic
1136276412 16:29181618-29181640 GGTTGAGCAAGCAGCTGCCCGGG - Intergenic
1136691323 16:32032887-32032909 ATTTTAGGATGCTGCTCCCTAGG - Intergenic
1136772622 16:32855080-32855102 ATTTTAGGATGCTGCTCCCTAGG - Intergenic
1136791911 16:32976452-32976474 ATTTTAGGATGCTGCTCCCTAGG - Intergenic
1136877906 16:33877456-33877478 ATTTTAGGATGCTGCTCCCTAGG + Intergenic
1136897992 16:34006439-34006461 ATTTTAGGATGCTGCTCCCTAGG + Intergenic
1138139138 16:54551968-54551990 GTAAGATGATGCAGCTGCTTTGG - Intergenic
1138298332 16:55906084-55906106 GTTTGAGGCTGCAGGTCCCTGGG - Intronic
1138897793 16:61229707-61229729 CTTTGAGGATGAAGCTTCCAGGG - Intergenic
1139265503 16:65634726-65634748 GTTTGATGATGCAGCTGGTAGGG - Intergenic
1139538963 16:67599482-67599504 GTGTGAGGATGCAAGGGCCTAGG - Intronic
1139898371 16:70307301-70307323 GATTAATGATGCAGCTGCTTTGG - Intronic
1140074751 16:71688016-71688038 GTTTGAGGAAGAAGGAGCCTGGG - Intronic
1141712961 16:85710598-85710620 GAATGAGGCTGCAGCTGGCTGGG - Intronic
1142045369 16:87921934-87921956 GATTGAGGCTGCAGTTACCTGGG - Intronic
1142080795 16:88147678-88147700 GGTTGAGCAAGCAGCTGCCCAGG - Intergenic
1203075047 16_KI270728v1_random:1117190-1117212 ATTTTAGGATGCTGCTCCCTAGG - Intergenic
1203094122 16_KI270728v1_random:1237916-1237938 ATTTTAGGATGCTGCTCCCTAGG - Intergenic
1142558579 17:796279-796301 TTTTGAGGAAGCAGCAGCCTTGG - Intergenic
1144066904 17:11632667-11632689 TTTTGATGATGCACCTGGCTTGG + Exonic
1144774337 17:17777494-17777516 GTTTGTAGATGCAAATGCCTAGG + Intronic
1144939604 17:18928974-18928996 GTGTGTGGGTACAGCTGCCTGGG + Intronic
1145209952 17:21005376-21005398 TTTTGAGGAGGCACCTGCCTAGG - Intronic
1146265450 17:31449772-31449794 GTTTGAGGCTGCAGCAAACTAGG - Intronic
1147343930 17:39774297-39774319 TTTTGAAGATTCAGCTGCCAGGG - Intronic
1147604423 17:41766181-41766203 GTTTGAGGATGCAGTGAGCTAGG + Intronic
1148990617 17:51663447-51663469 GTTTGAGGTTGCAGGAGCATGGG - Intronic
1149270173 17:54968728-54968750 GGTTGAGCCTGCCGCTGCCTTGG + Exonic
1149508090 17:57212707-57212729 GTTTGAGGCTGCAGTGGGCTAGG - Intergenic
1151292873 17:73163181-73163203 GCTTGGGGGAGCAGCTGCCTGGG - Intergenic
1151927693 17:77210986-77211008 GCCTCAGGATGGAGCTGCCTGGG + Intronic
1152465747 17:80465126-80465148 ATTTGAGGAGGCTGCTGCATGGG + Intergenic
1152897865 17:82923645-82923667 GTTTTAGGATGCAGCAGTCTCGG + Exonic
1152945891 17:83197176-83197198 GGTGGAGGCTGCAGCTCCCTGGG + Intergenic
1153571109 18:6474733-6474755 GATTGAGGCTGCAGCAGCCTGGG - Intergenic
1153656804 18:7290027-7290049 CTTTTAGGCTGCAGGTGCCTCGG + Intergenic
1155529365 18:26750592-26750614 GTTTGAGGCTGCAGCGAGCTAGG - Intergenic
1156050073 18:32921959-32921981 GATAGAGCATGCAGCTGGCTTGG - Intergenic
1157103258 18:44749148-44749170 GTATGATTATGCATCTGCCTTGG - Intronic
1159015772 18:63100727-63100749 GTTTGGGGATGCAGCTGTCAGGG - Intergenic
1160535909 18:79591249-79591271 AACTGAGGATGCAGATGCCTCGG + Intergenic
1160978817 19:1807139-1807161 GCTGTTGGATGCAGCTGCCTGGG - Intronic
1161021862 19:2014694-2014716 GTTTGAGGATGGAGGGGCCCAGG + Intronic
1161060971 19:2214677-2214699 GGTTGCGGTTGCAGCAGCCTAGG + Intronic
1161715440 19:5873722-5873744 GATTCAGGATGCAGCTGGATGGG - Intronic
1162179173 19:8855622-8855644 GTTTAACACTGCAGCTGCCTGGG + Intronic
1163271836 19:16259093-16259115 GTTTTAAGATGCAGATTCCTGGG - Intergenic
1163613896 19:18315215-18315237 GTTTGAGGTTGCAGGTCGCTGGG - Intronic
1163960450 19:20685180-20685202 CTTTGATGATCCAACTGCCTTGG + Intronic
1164144707 19:22504893-22504915 GTTGCAGCATCCAGCTGCCTAGG - Intronic
1165316983 19:35061987-35062009 GTTTGAGGCTGCAGTGGGCTAGG + Intronic
1167145837 19:47680529-47680551 GGATGACGATGCTGCTGCCTTGG - Exonic
1167727287 19:51225096-51225118 GTCTGAGGAAGCAGCTTCCAGGG - Exonic
925439112 2:3868581-3868603 GTTTGAACAGTCAGCTGCCTAGG + Intergenic
925443309 2:3907012-3907034 GGTTGAGGGTGGAGCTGTCTGGG + Intergenic
926697707 2:15782363-15782385 GTGTGAGGCTGCGGCTGCCCCGG + Intergenic
928251405 2:29684517-29684539 GTTTTAGGCTGTGGCTGCCTTGG + Intronic
930132437 2:47866175-47866197 GTTTGAGGCTGCAGTGACCTAGG + Intronic
932028955 2:68163825-68163847 GTCTGAGGTTGAAGCTGCCCAGG + Intronic
933787212 2:85852922-85852944 GTTTGAAGATGCTGGTGCCTGGG + Intronic
933794437 2:85908189-85908211 GGTTCAGGATGCTGATGCCTGGG - Intergenic
934761444 2:96859100-96859122 GCTTGAGCAGGCAGCTGCCTGGG - Intergenic
936675704 2:114711408-114711430 GGTTCAGGATCCAGCTGCCTGGG + Intronic
936988933 2:118341614-118341636 GTTTCTGGAGGCAGCTGCTTTGG + Intergenic
937980750 2:127613736-127613758 GTTTTAGGAGGCAACTACCTTGG + Intronic
938275654 2:130019194-130019216 GTGGGAGGATTCAGCTACCTTGG + Intergenic
938293048 2:130160520-130160542 CATAGAGGTTGCAGCTGCCTAGG - Intronic
938463507 2:131512446-131512468 CATAGAGGTTGCAGCTGCCTAGG + Intergenic
938722803 2:134081179-134081201 GGTTGAGGATGTAGCAGCATGGG + Intergenic
943933561 2:193885819-193885841 ATTTCAGGATGTAGCTCCCTGGG + Intergenic
946161106 2:217836578-217836600 GTTGGTTGATGCAGTTGCCTTGG - Intronic
946295838 2:218782707-218782729 GGTTGAGGAGGGAGCTGTCTTGG + Intronic
947178785 2:227393767-227393789 GCTAGATGCTGCAGCTGCCTTGG - Intergenic
947229711 2:227872566-227872588 GTTTGAGGAAGCAGCAGGATTGG - Intronic
947929670 2:233953127-233953149 TTTTGAGGCTGCAGCTGCCTGGG - Intronic
947979327 2:234395751-234395773 GGATGAGGAGGCAGCTCCCTTGG + Intergenic
948674014 2:239586690-239586712 GTAAGAGGATGCACCTGCCCGGG - Intergenic
1170022473 20:11851617-11851639 GTTGGGGGATGGAGCTGACTGGG + Intergenic
1170836216 20:19886821-19886843 GTTTTAGGATGAAGCTGCTGGGG + Intronic
1171445488 20:25200058-25200080 GTCAGATGGTGCAGCTGCCTTGG - Intronic
1171807791 20:29700588-29700610 TTATGAGAATGCATCTGCCTCGG + Intergenic
1173224352 20:41153359-41153381 GTTTGAGGCTGCAGATGAGTAGG - Intronic
1174055698 20:47796708-47796730 ACTTGAGGGTGCAGCAGCCTTGG + Intergenic
1174226599 20:49005819-49005841 GTTTGAGGATGCTTCTGCAGTGG - Intronic
1178696037 21:34793131-34793153 TACTGAGGATGCTGCTGCCTAGG + Intronic
1178912047 21:36682864-36682886 GGTTGAGGAAGCAGATGCTTGGG + Intergenic
1178968256 21:37145531-37145553 GTATAATGATGCAGCTGCTTTGG + Intronic
1179178013 21:39022646-39022668 GAGTGAGCATGCAGGTGCCTGGG - Intergenic
1179246379 21:39637514-39637536 GTATGCGGAAACAGCTGCCTGGG + Intronic
1179624842 21:42643098-42643120 CTCTGAGGTTGCAGCTGCCTGGG - Intergenic
1179666895 21:42919119-42919141 TTTGGAGGAAGAAGCTGCCTTGG + Intergenic
1180841233 22:18959826-18959848 GCATGAGGATGCAGCTGGCCCGG + Intergenic
1180907310 22:19423587-19423609 GTTAGAGGATGCAGCAGACCTGG + Intronic
1181060264 22:20278968-20278990 GCATGAGGATGCAGCTGGCCCGG - Intronic
1181492459 22:23269078-23269100 GTTTGAGGTTTCAGCTTCCTGGG - Intronic
1181888724 22:26042268-26042290 CTTTTAGGATGCAGCTGGCAGGG - Intergenic
1181912977 22:26255260-26255282 GTTTGTAAATGCAGATGCCTGGG - Intronic
1182090834 22:27593718-27593740 GGTTGTGGCTGAAGCTGCCTGGG - Intergenic
1182097683 22:27637184-27637206 GTTTTAGGATGCAGATTCCCTGG - Intergenic
1183151463 22:36041088-36041110 GTTTGAGTATGCAGCTGAACTGG + Intergenic
1184058125 22:42066164-42066186 GTTTGTGGGTGCACCAGCCTGGG - Intronic
1185391530 22:50563962-50563984 TATTGAGGAGGCTGCTGCCTGGG + Intergenic
950667894 3:14508316-14508338 TTTTGAAAATGCAGGTGCCTGGG + Intronic
950785434 3:15430333-15430355 GTCTGTGGTTGCAGCTGCTTGGG + Intronic
952751839 3:36831194-36831216 GTTTGAGGGGGCAGCTTCCGAGG - Exonic
953273429 3:41469456-41469478 TTTTGATGAGGCAGCTGGCTGGG - Intronic
953701815 3:45201863-45201885 CTTTGAGGCTGCAGATGCCAGGG + Intergenic
954729354 3:52644914-52644936 GTTGGAGGATGCAGCTTTGTGGG - Intronic
954958151 3:54540223-54540245 GTTTGAGGATGCCGCTGAATTGG - Intronic
955088441 3:55725885-55725907 GGTTGAGGCACCAGCTGCCTAGG + Intronic
955698632 3:61661139-61661161 GTTTGAGGCTGCAGTAGGCTAGG - Intronic
958120168 3:89276327-89276349 GAATGAGGATGCCTCTGCCTGGG + Intronic
960157937 3:114317062-114317084 GTTTGAGCATGCAGGGGCCATGG - Intergenic
960271193 3:115676356-115676378 CTCTGAGGATGCAGGAGCCTGGG - Exonic
962436521 3:135372028-135372050 GTGTGAGGATGAAGGAGCCTAGG - Intergenic
962904855 3:139792432-139792454 GTTTGAGGAGGTAGCTTCCTGGG + Intergenic
963725153 3:148911659-148911681 CTTTGAGGATGCTGATGTCTGGG + Intergenic
965669559 3:171133080-171133102 GTTTGAGGATGCCCCTGCTCCGG + Intronic
968540570 4:1166311-1166333 GTTTGAGGATGGAGATGCTTGGG - Intergenic
968642043 4:1719862-1719884 GTTTGAGGATGCAGCTGCCTGGG - Intronic
968856854 4:3131600-3131622 GTTTGAGGCTGAAGGTGGCTTGG + Intronic
972556328 4:40184720-40184742 CTTTGATGATCCACCTGCCTCGG - Intergenic
976423378 4:84871701-84871723 GTTTGAGGCTGCAGTGGGCTGGG - Intronic
976750065 4:88444573-88444595 TATTGAGGATGCAGCTGAGTGGG - Intergenic
977043235 4:92039881-92039903 GTGAGAAGATTCAGCTGCCTTGG - Intergenic
978193920 4:105948687-105948709 GATTGAAGCTGCAGCAGCCTGGG - Intronic
978574804 4:110178782-110178804 GACTGAGGCTGCAGCAGCCTCGG + Intronic
979341807 4:119534206-119534228 GTTTGAGGAAGATGATGCCTTGG + Intronic
981532244 4:145763936-145763958 TTTTGAGGAGGCAGGGGCCTGGG + Intronic
983378702 4:166963085-166963107 ATTTGATGATGCAGGTTCCTAGG - Intronic
984747854 4:183240636-183240658 GTGTGAGCCTGCAGCTGCCCTGG + Intronic
985816901 5:2134054-2134076 GTTTGGGGACCCAGCTGGCTGGG + Intergenic
987280784 5:16411711-16411733 TTGTGAGGAGGGAGCTGCCTTGG + Intergenic
988129971 5:27091594-27091616 TTCTGAGAATGAAGCTGCCTTGG + Intronic
990670004 5:58117669-58117691 ATTTGAAGATGCAGTAGCCTTGG - Intergenic
990937039 5:61162378-61162400 GTTGGTGGCTGCAGCTGCCGTGG - Exonic
992584531 5:78222367-78222389 CTTTAATGCTGCAGCTGCCTTGG - Intronic
992765205 5:79991799-79991821 TTTTGAGGGAGCAGCTGCATAGG - Intronic
992792856 5:80229047-80229069 TTTTGGGGATGGAGTTGCCTAGG + Intronic
993210420 5:84942952-84942974 GTATGAGGATGCAGCTCCACTGG - Intergenic
993379216 5:87186778-87186800 GTTTGCAGATGAAACTGCCTAGG - Intergenic
995181139 5:109231314-109231336 GTTTGAGGATGCAGTGAGCTAGG + Intergenic
995881557 5:116849715-116849737 TTTTGAGGACTTAGCTGCCTTGG + Intergenic
995927112 5:117387128-117387150 GTTTGAGGCTGCAGCTGGACCGG - Intergenic
997420614 5:133763944-133763966 GTAGCAGGAAGCAGCTGCCTTGG - Intergenic
998285406 5:140856052-140856074 GTTTCCAGATGTAGCTGCCTGGG + Exonic
998361406 5:141591171-141591193 GGCTGAGGAGGCAGCAGCCTAGG - Intronic
1001564153 5:172688777-172688799 GTTTGAGAATCCAGCAGCCCTGG + Exonic
1002187198 5:177459877-177459899 GTGTGAGGCTGCGGCTGGCTTGG - Intronic
1002619208 5:180475018-180475040 GTTTCAGCAGGCAGCTGCCCAGG - Intergenic
1002826952 6:782776-782798 TTCTGATGGTGCAGCTGCCTGGG - Intergenic
1003572930 6:7267819-7267841 GTTTTAAAATGCAGCTTCCTGGG + Intergenic
1004546617 6:16604031-16604053 GTTTGTGGATTCAGCTTCCATGG - Intronic
1006049490 6:31330617-31330639 GTCTCAGGATGCAAATGCCTGGG - Intronic
1007322671 6:41038748-41038770 GCTGGAGGATGCAACTGCCTAGG - Intronic
1007589614 6:43013497-43013519 GGTGGAGGATGCAGGAGCCTCGG - Intronic
1007651868 6:43427700-43427722 GTTTGAGGTTCCGGATGCCTGGG + Exonic
1013167093 6:107604341-107604363 GTTAGTGGATACAGCAGCCTCGG + Intronic
1014814206 6:125917623-125917645 GGTTGAGGATGCATCTGGTTAGG + Intronic
1015198907 6:130556042-130556064 CTTTGAGTATGCAGCTCACTTGG + Intergenic
1015421553 6:133016085-133016107 ATTTGAGGATGCAGCCACATAGG + Intergenic
1016721998 6:147309561-147309583 GTTTGAGAATGCATCAGCCAAGG + Intronic
1016852449 6:148634973-148634995 ATTTGAGGAAGCAGTTGCTTGGG + Intergenic
1019288404 7:235081-235103 GTTTGAAAATGCCGCAGCCTGGG - Intronic
1019288408 7:235117-235139 GTTTGAAAATGCCGCAGCCTGGG - Intronic
1019288412 7:235153-235175 GTTTGAAAATGCCGCAGCCTGGG - Intronic
1021885918 7:25138996-25139018 GGAAGAGGATGCAGCTGACTGGG + Intronic
1021891255 7:25188278-25188300 TTTTGAGGAAGCAGTTGTCTAGG + Intergenic
1022166356 7:27766715-27766737 ATTTGGGGATGAAGCTGCTTGGG + Intronic
1023958645 7:44908446-44908468 TTTTAAGACTGCAGCTGCCTGGG - Intergenic
1024073965 7:45809264-45809286 TTGTGAGGCAGCAGCTGCCTGGG - Intergenic
1024289520 7:47792006-47792028 GTTTGTTGATGTGGCTGCCTAGG - Intronic
1024649367 7:51390934-51390956 TTGTGAGGCAGCAGCTGCCTGGG + Intergenic
1025053446 7:55746263-55746285 TTGTGAGGCAGCAGCTGCCTGGG + Intergenic
1025182350 7:56829803-56829825 TTGTGAGGCAGCAGCTGCCTGGG + Intergenic
1025689577 7:63747191-63747213 TTGTGAGGCAGCAGCTGCCTGGG - Intergenic
1026021953 7:66715194-66715216 GTTTGAGGATGCAGTGAGCTAGG - Intronic
1026491146 7:70864730-70864752 GTTAAATGATGCAGCTGCTTTGG - Intergenic
1026621206 7:71951355-71951377 CTTAGGTGATGCAGCTGCCTCGG - Intronic
1026900840 7:74036635-74036657 GTCTGAGGATGCATGTGGCTCGG - Intronic
1030605387 7:111633876-111633898 GTGTCATGCTGCAGCTGCCTGGG + Intergenic
1031972665 7:128075543-128075565 GAATGAGGAGGCAGCTGCTTGGG - Intronic
1033546862 7:142409173-142409195 GTTTGGGAAGGCAGCTTCCTGGG + Intergenic
1033549740 7:142436119-142436141 GTTTGGAAATGCAGCTTCCTGGG + Intergenic
1036561941 8:9905714-9905736 GGTTGAGGAGGCAGCACCCTCGG + Intergenic
1037362401 8:18087509-18087531 GTTTGAGGATAGAGTTGTCTAGG - Intergenic
1037832688 8:22198686-22198708 GCTTGAGGATGCAGGACCCTGGG - Intronic
1038037465 8:23698742-23698764 GTATCAGGATGGAGCTGGCTTGG + Intergenic
1038200476 8:25408261-25408283 GTTTCAGGACTCAGCAGCCTGGG + Intronic
1041883809 8:62785016-62785038 GTAGGATGATGCAGCTGCTTTGG + Intronic
1042020711 8:64369901-64369923 TTCTGAGGAAACAGCTGCCTCGG + Intergenic
1043064270 8:75546954-75546976 GTTAAATGATGCAGCTGCTTTGG - Intronic
1043167521 8:76922696-76922718 GTGTGAGGCTGCATCTGTCTAGG + Intergenic
1043491147 8:80750164-80750186 GTTCCATGTTGCAGCTGCCTGGG - Intronic
1044731211 8:95229923-95229945 ATGTGAGGCTGAAGCTGCCTGGG + Intergenic
1044995630 8:97835666-97835688 TTTTGAGTCTGCAGCTCCCTTGG + Intronic
1045389716 8:101703500-101703522 GTTTGTGGTTGCTGCTGCTTCGG - Intronic
1047422883 8:124721826-124721848 GCTTGGAGATGCTGCTGCCTGGG - Intronic
1047759549 8:127944154-127944176 GTTTGAGGATGCAGTGAACTAGG - Intergenic
1048389388 8:133947305-133947327 GTTCTAGGATGTGGCTGCCTTGG - Intergenic
1053559652 9:39176966-39176988 GTTTGACTATGCAGATTCCTGGG - Intronic
1053823760 9:41997221-41997243 GTTTGACTATGCAGATTCCTGGG - Intronic
1054137463 9:61441977-61441999 GTTTGACTATGCAGATTCCTGGG + Intergenic
1054606811 9:67190137-67190159 GTTTGACTATGCAGATTCCTGGG + Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1059181397 9:112216040-112216062 GTTTGAGGCTGCTTCAGCCTGGG + Intergenic
1059581382 9:115552269-115552291 GCTTGATGCTCCAGCTGCCTGGG - Intergenic
1060341227 9:122778728-122778750 GTTTGTTGATGCTGCAGCCTGGG - Intergenic
1061476743 9:130872707-130872729 GTCTCAGGATGCAGGTGCTTGGG + Intronic
1185890438 X:3817090-3817112 GTTTGAGGATGCAGTGAGCTAGG - Intergenic
1186022660 X:5273701-5273723 GTTTGAGGCTGCAGTAGGCTAGG + Intergenic
1188923826 X:36013307-36013329 GTTTTATGATTCACCTGCCTGGG + Intergenic
1189805877 X:44735218-44735240 GTTTGAAAATGCAGATTCCTGGG + Intergenic
1190486963 X:50936983-50937005 GTATAATGATGCAGCTGCTTTGG - Intergenic
1192047001 X:67686390-67686412 GAGTGAGGATGCATCTGACTGGG + Intronic
1195786151 X:108526168-108526190 GTTTATGGATGCACCTACCTTGG + Intronic
1196025080 X:111033575-111033597 ATTTGGGAATGCAGCTCCCTTGG + Intronic
1197131923 X:123015125-123015147 GTTTGAGGCTGCAGTGGGCTAGG + Intergenic
1198821676 X:140654716-140654738 GTTTGAGGCTGCAGCGAGCTAGG + Intergenic
1198878596 X:141254358-141254380 GTTTCACACTGCAGCTGCCTTGG + Intergenic
1200108494 X:153726978-153727000 GCCTGGGGTTGCAGCTGCCTTGG + Intronic
1201464443 Y:14265003-14265025 GTTTGAGGGTCCAGCAGTCTAGG - Intergenic
1201901445 Y:19048621-19048643 GTTTGGGGAGGGAACTGCCTGGG - Intergenic
1201910458 Y:19128540-19128562 GTTTGGGGTGGCAGCTGCTTGGG - Intergenic