ID: 968642495

View in Genome Browser
Species Human (GRCh38)
Location 4:1721590-1721612
Sequence CCTTCCTGGCGGCGGCGGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 1, 2: 4, 3: 36, 4: 255}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968642486_968642495 3 Left 968642486 4:1721564-1721586 CCGGCGTGGAGCAGACGCGGACC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 968642495 4:1721590-1721612 CCTTCCTGGCGGCGGCGGCGCGG 0: 1
1: 1
2: 4
3: 36
4: 255
968642485_968642495 4 Left 968642485 4:1721563-1721585 CCCGGCGTGGAGCAGACGCGGAC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 968642495 4:1721590-1721612 CCTTCCTGGCGGCGGCGGCGCGG 0: 1
1: 1
2: 4
3: 36
4: 255
968642484_968642495 5 Left 968642484 4:1721562-1721584 CCCCGGCGTGGAGCAGACGCGGA 0: 1
1: 0
2: 0
3: 3
4: 56
Right 968642495 4:1721590-1721612 CCTTCCTGGCGGCGGCGGCGCGG 0: 1
1: 1
2: 4
3: 36
4: 255
968642482_968642495 6 Left 968642482 4:1721561-1721583 CCCCCGGCGTGGAGCAGACGCGG 0: 1
1: 0
2: 0
3: 4
4: 46
Right 968642495 4:1721590-1721612 CCTTCCTGGCGGCGGCGGCGCGG 0: 1
1: 1
2: 4
3: 36
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968642495 Original CRISPR CCTTCCTGGCGGCGGCGGCG CGG Exonic
900113607 1:1019770-1019792 ACTTCCGGGGGGCCGCGGCGGGG + Intergenic
900180129 1:1307654-1307676 CCTCCCCGGCGGCCGCGGCCCGG + Intronic
900244447 1:1630872-1630894 CCGTCCTGGGGGCGGCCGCGGGG + Intergenic
900305287 1:2003789-2003811 CCTCCGCGGCGCCGGCGGCGTGG + Exonic
900360020 1:2283927-2283949 CCTTCCTGCAGGAGGCGGGGAGG + Intronic
902375284 1:16027465-16027487 CCTGCCTGGGGGCCGGGGCGAGG + Intronic
902380246 1:16049275-16049297 CCTGCCTGGGGGCCGGGGCGAGG + Intronic
902690539 1:18107961-18107983 GCTGCCTGGCCGCGGCGGCATGG + Exonic
902823253 1:18956263-18956285 CCCGCCGGGCGGCGGCGGCGGGG - Exonic
902940805 1:19799393-19799415 CCTTCCTGACGGGGGCGTGGAGG + Intronic
903910827 1:26723605-26723627 CCTTCCTGGCAGGGGCGGTGTGG + Intronic
904620454 1:31772032-31772054 CCGTGGCGGCGGCGGCGGCGCGG + Intergenic
904690824 1:32292226-32292248 CCGTCCTCGCGGCGGGGGCGGGG + Intronic
904882707 1:33712787-33712809 CCTTCCTGGGGTGGGTGGCGGGG + Intronic
905867031 1:41382128-41382150 CCTGCACGGCGGCGGCGGCGCGG + Exonic
905912232 1:41662626-41662648 CCTGGCTGCCGGCGGCCGCGGGG + Intronic
906264412 1:44417708-44417730 CCCTTCTGCCGGCAGCGGCGAGG - Intronic
906405574 1:45539340-45539362 CCTTCCTGGAGGGGGAGGGGGGG + Intergenic
906961010 1:50419471-50419493 TGGCCCTGGCGGCGGCGGCGAGG - Exonic
911664810 1:100540016-100540038 CCTGCCGGGCGTCGGCGACGCGG + Exonic
913960441 1:143334680-143334702 TCTTCCTGGCAGCAGCGGCCTGG - Intergenic
913994820 1:143643253-143643275 CCATCCAGGCGGCAGCGGCGCGG + Intergenic
914054797 1:144160253-144160275 TCTTCCTGGCAGCAGCGGCCTGG - Intergenic
914124349 1:144806108-144806130 TCTTCCTGGCAGCAGCGGCCTGG + Intergenic
914758270 1:150579027-150579049 CTCTGCTGGCGGCGGCGTCGAGG + Exonic
914847757 1:151292317-151292339 CCTTGCTGGCGGGCGCTGCGTGG - Exonic
915312186 1:155010375-155010397 ACTTCCTGGGGGCCGAGGCGGGG - Exonic
917451482 1:175151101-175151123 ACTACCTGTCGGCGGCGGCAGGG + Intergenic
917919990 1:179743336-179743358 CCTTCCGGGCGCCAGCGGCTGGG - Exonic
922790421 1:228308027-228308049 GCTTCCTGGAGGAGGGGGCGTGG + Intronic
1063504015 10:6580173-6580195 GCTCCCTCCCGGCGGCGGCGCGG + Intronic
1064981955 10:21174165-21174187 CCTGCGCGGCGGCGGCGGCGAGG - Intronic
1065025470 10:21535378-21535400 GCTACCGGGCGGCGGCGGCAGGG - Intronic
1065099929 10:22321966-22321988 CCCTGCTGGCGGCGGCGGCGCGG - Intronic
1065589784 10:27252573-27252595 CGCCCCTGGCGGCGGCGGCGGGG - Intergenic
1070032615 10:72692193-72692215 CTCTCGGGGCGGCGGCGGCGGGG + Exonic
1070954275 10:80454256-80454278 CCGTCCGAGCGGCGGGGGCGGGG - Exonic
1072719463 10:97771813-97771835 CCATGCGGGCGGCGGCGGCGGGG - Exonic
1072731497 10:97849968-97849990 CTTTGGCGGCGGCGGCGGCGGGG - Intergenic
1073069774 10:100785957-100785979 CCTTCCTGGGGGCTGTGGAGAGG + Intronic
1073325574 10:102642673-102642695 CCTTCCTCGCGGCGGCGGCGAGG + Intergenic
1073360088 10:102891283-102891305 CATTCCTGGTGGAGTCGGCGCGG + Intronic
1073403501 10:103277295-103277317 CCTCTCTGGGGCCGGCGGCGCGG + Exonic
1074818649 10:117163338-117163360 GCTTCTTGAAGGCGGCGGCGGGG + Intergenic
1074826130 10:117216839-117216861 CCTTCCTCGCGGCGAAGGCGGGG - Intergenic
1076554240 10:131311645-131311667 CCGCGCTGACGGCGGCGGCGGGG + Exonic
1076864467 10:133160203-133160225 CCTTCCTGGGGGAGGCACCGGGG - Intergenic
1077102900 11:830078-830100 CCTGCCTGGAGGAGGCGGCCCGG + Exonic
1077285573 11:1763853-1763875 GCTGCATGGCGGCGGCGGCCGGG + Exonic
1077485309 11:2835795-2835817 CCTTCCTCATGGAGGCGGCGGGG + Intronic
1078420672 11:11209521-11209543 CAATCCTGGCGGGGGCGGGGGGG + Intergenic
1079172092 11:18106006-18106028 GCGACCCGGCGGCGGCGGCGAGG + Exonic
1079353684 11:19713644-19713666 CGTCCCTGGCAGCGGCGGCGGGG - Exonic
1081807900 11:45900158-45900180 CTCTGCGGGCGGCGGCGGCGCGG + Exonic
1082807726 11:57461031-57461053 CAGCCCTGGCGGCGGGGGCGCGG - Intronic
1083365631 11:62140097-62140119 CCTTCCTGGCAGCTCCGGGGTGG - Intronic
1083617960 11:64035773-64035795 CCCTCGCGGCGGCGGCGGCGGGG - Intronic
1083970306 11:66070406-66070428 CCCCCGCGGCGGCGGCGGCGGGG - Intronic
1084165295 11:67372607-67372629 CCTTCCCCGCGGCGGGGGCGGGG + Intronic
1084653623 11:70502799-70502821 TCTTCCTGGCGGTGTCGTCGGGG + Exonic
1087785307 11:102347389-102347411 CCTTCCGGGCTCGGGCGGCGTGG + Exonic
1090194052 11:124800110-124800132 CCCTGGTGGCGGCGGTGGCGGGG - Exonic
1091001098 11:131911210-131911232 CCTTCCCGGCGGAAGCAGCGAGG + Intronic
1091225745 11:133955906-133955928 GCTGGCTGGGGGCGGCGGCGGGG - Intronic
1096460716 12:51820389-51820411 CCTCCCACGCGGAGGCGGCGGGG + Intergenic
1100404712 12:94263204-94263226 CCTTCCCGGGGCCGGGGGCGGGG - Intronic
1101150363 12:101877704-101877726 GCTGCCTGGAGGCGGCGGCCGGG - Exonic
1101441592 12:104708322-104708344 CCTTCCCGGGGGCGGCTGTGGGG + Intronic
1102256427 12:111418195-111418217 CCTCCCCGGCGGCGGCCCCGCGG + Exonic
1102678076 12:114672069-114672091 CCTCCATGGCGGCGGCCGCGGGG - Exonic
1104841849 12:131829342-131829364 CCTGCCTGGGGGCAGCGACGTGG + Intronic
1104846294 12:131848757-131848779 CCTTCCTGGCTGAGGCTGAGCGG + Intronic
1106036691 13:26050880-26050902 CGCTGCTGGCGGCGGGGGCGAGG - Exonic
1106227088 13:27793783-27793805 CCATCGTGGCGGCGGCGGCGGGG + Exonic
1107454026 13:40537654-40537676 TCTTCCTGGCGGCGGGGCTGTGG - Intergenic
1111672461 13:91348058-91348080 GCAGCGTGGCGGCGGCGGCGTGG + Intergenic
1112328582 13:98460159-98460181 CATTCCAGGCTGCGGCGGAGTGG + Intronic
1114056128 14:18968061-18968083 CCCTCCTGGCGGGGGAGGAGGGG + Intronic
1114106423 14:19433692-19433714 CCCTCCTGGCGGGGGAGGAGGGG - Intronic
1116658133 14:47675676-47675698 TCCACCTGGCGGGGGCGGCGCGG - Intergenic
1119484917 14:74980924-74980946 CCACGGTGGCGGCGGCGGCGCGG + Intergenic
1119572520 14:75688213-75688235 CCTTCCTGGAGGCTGAGGGGTGG - Intronic
1121417509 14:93789097-93789119 CGGCGCTGGCGGCGGCGGCGGGG - Intergenic
1122445239 14:101762456-101762478 CCTGGGTGGCGGCGGCGGTGAGG + Intronic
1122582220 14:102777818-102777840 CCGTCCCAGCGGCGACGGCGGGG + Intronic
1122635373 14:103127263-103127285 ACCGCCAGGCGGCGGCGGCGGGG + Exonic
1122750398 14:103928601-103928623 CCTTCCCGGCAGGGGCGGCCAGG + Exonic
1123048182 14:105528380-105528402 CCCTCCTGGCTCCGGCGGCCCGG - Intronic
1123048215 14:105528486-105528508 CCTTCCTGGCGGCGGGAACGAGG + Intronic
1125536062 15:40441606-40441628 TCGGCCGGGCGGCGGCGGCGCGG + Intronic
1126502921 15:49366763-49366785 CCTCCGTGGCGGGGGCGGCCGGG + Intronic
1127867271 15:63042814-63042836 CGTCCATGGTGGCGGCGGCGAGG - Exonic
1128109676 15:65068338-65068360 GCTTCCTGGAGGAGGAGGCGGGG - Intronic
1130370803 15:83284337-83284359 CCGGCCGGGAGGCGGCGGCGGGG - Intronic
1130564541 15:84982144-84982166 CCATGCTGGCGGCGGCGCCGCGG - Exonic
1131827376 15:96332050-96332072 CCTGGCTGCGGGCGGCGGCGGGG - Exonic
1132559986 16:589263-589285 ACTTCCGCCCGGCGGCGGCGGGG - Intergenic
1132585805 16:705392-705414 CTTCCCGGGCGGCGGCGGCGCGG + Intronic
1133071541 16:3249732-3249754 CCTTCCTGGGCGTGGCAGCGGGG + Exonic
1133465191 16:6020822-6020844 CCTCCCTGGCGCCAGCTGCGGGG + Intronic
1134482315 16:14630290-14630312 CCTGCGCGGCGGCGGGGGCGGGG + Intronic
1135517669 16:23149156-23149178 CCGCGCTGGCGGCGGCGGCGCGG - Exonic
1135635306 16:24070718-24070740 ACTTCCTGGCTGCGGAGGCTTGG - Intronic
1136003541 16:27313776-27313798 ACTGTCCGGCGGCGGCGGCGGGG + Intronic
1136408846 16:30065060-30065082 CCAGCCTGGCTGCGGCGGCCCGG + Intronic
1138420066 16:56893081-56893103 CCTGCCCGGCGGGGGCGGGGTGG + Intronic
1139528149 16:67528983-67529005 CCCACCGGGCGGCGCCGGCGGGG - Intronic
1139761433 16:69187382-69187404 CCTCCCAAACGGCGGCGGCGCGG + Exonic
1140519053 16:75566471-75566493 ACTTCATGGCGGCGGCGGGAAGG - Exonic
1141054743 16:80804537-80804559 GCTTCCTGCAGGCGGCGCCGGGG - Intergenic
1142174402 16:88638626-88638648 CCGTCATGGTGGCGGCAGCGGGG - Exonic
1142863374 17:2776690-2776712 CGTGCGCGGCGGCGGCGGCGAGG + Intergenic
1143223708 17:5282557-5282579 CCTGCCCGGCGTCGGCGTCGCGG + Intronic
1144758595 17:17694700-17694722 CCCTCCCGGCGTCGGCGTCGCGG - Intronic
1144800032 17:17919857-17919879 CCTTCCTGGCGGCTGGGGCGTGG - Intronic
1145327702 17:21844353-21844375 CCCTCAGAGCGGCGGCGGCGGGG - Intergenic
1145765511 17:27456263-27456285 CCCTCCCGGCGGCCGCGGCGAGG - Intergenic
1146258323 17:31404714-31404736 CCTTCCCTGCGGTGGGGGCGGGG + Intronic
1146332339 17:31937419-31937441 CCTCCGCGGCGGCAGCGGCGGGG + Exonic
1146763504 17:35498164-35498186 CGATCCGGGAGGCGGCGGCGTGG + Intronic
1147358653 17:39917583-39917605 CCTTCTTAAGGGCGGCGGCGGGG - Intronic
1147609782 17:41794636-41794658 CCTTCCTGGAGGAGGAGGCTGGG - Intergenic
1148268239 17:46243605-46243627 CTCTGCGGGCGGCGGCGGCGCGG + Intergenic
1148741358 17:49894888-49894910 ACTTCCTGGCGGCGGCGGAAGGG + Intergenic
1148846508 17:50533006-50533028 CCTCCCTGGCAGTGGCGGCATGG + Intronic
1150572979 17:66404369-66404391 CCTTCATGGGGGCGGCGGAGGGG + Intronic
1150621917 17:66814158-66814180 CCTTCCTGGGGGAGGAGGCAGGG + Intergenic
1150983523 17:70169563-70169585 CCTTCCCGGCGCCGGCGGGCTGG + Exonic
1151155868 17:72122745-72122767 CCTTCGTGGAGGAGGCGGAGCGG + Exonic
1151570600 17:74923646-74923668 CCGTTCAGGCGGCGGCGGCCTGG - Intergenic
1152361141 17:79833743-79833765 CCTTCCACGCGGTGCCGGCGGGG - Exonic
1152797412 17:82315070-82315092 GCTTCCTCCCGGTGGCGGCGTGG + Exonic
1154358973 18:13643341-13643363 CCTTCCTGGCGGAGGGGAAGGGG - Exonic
1154940749 18:21111224-21111246 CCTCCATGGCGACGGCGGCCGGG - Exonic
1159040703 18:63320455-63320477 CCTCCCGCGCGGCCGCGGCGCGG + Intergenic
1159045649 18:63366902-63366924 CCTTCCTGGGGACCGCGGCCTGG + Intronic
1159798036 18:72867595-72867617 GGGTCCTGACGGCGGCGGCGCGG - Exonic
1160138513 18:76296614-76296636 CCTCTCTGGCGGCGGCTGTGTGG - Intergenic
1160453336 18:78979740-78979762 GCCGCCCGGCGGCGGCGGCGGGG + Intergenic
1160499848 18:79396206-79396228 GCATCCGCGCGGCGGCGGCGGGG - Exonic
1160522083 18:79513568-79513590 CTTTCCCGCCGGCGGGGGCGTGG + Intronic
1160991602 19:1862580-1862602 CCACCCCGGCGGCGGCGACGCGG + Intronic
1161348535 19:3779613-3779635 TCTTCCTGGGGGCGGTGGGGTGG + Exonic
1161350010 19:3786196-3786218 CCCTCCTGGGGGCGGGCGCGGGG - Intronic
1161395708 19:4043848-4043870 CCTTCCTGGAGGTGGGGGGGGGG - Intergenic
1161438820 19:4279338-4279360 CCCACCTCCCGGCGGCGGCGGGG + Exonic
1161461901 19:4402718-4402740 CCTCTCAGGCGGCGGAGGCGCGG - Exonic
1161802637 19:6424551-6424573 CGGTCCCGGCGGCGGCGGCCCGG - Exonic
1162426905 19:10602515-10602537 CCTCCATGGCCGCGGCGGGGCGG - Intronic
1162959467 19:14117544-14117566 CCATCGCGGCGGCGGCGGCCGGG + Exonic
1163138826 19:15332570-15332592 CACACCGGGCGGCGGCGGCGCGG - Intergenic
1163329625 19:16628118-16628140 CTTTGGTGGCGGCGGCGGCCCGG - Exonic
1163583742 19:18153310-18153332 CCCTCGTGGCGGGGGCGGCTGGG + Intronic
1164658546 19:29942332-29942354 GCTGCGGGGCGGCGGCGGCGGGG + Exonic
1165862916 19:38918526-38918548 CCTTCCTGGGGGAGGAGGCCAGG + Exonic
1166092546 19:40519649-40519671 GCTTCCCGGCGCAGGCGGCGCGG + Exonic
1167233066 19:48297455-48297477 GCTTCGCGGCGGCGGCGGCCAGG + Exonic
1167292233 19:48630650-48630672 CCTCCCTTGCGGGGGCGGGGAGG - Exonic
1168307275 19:55442429-55442451 CCCAGCTAGCGGCGGCGGCGTGG + Exonic
1168336503 19:55600298-55600320 CCTGCCCCTCGGCGGCGGCGAGG - Intronic
1168693803 19:58393838-58393860 CCTTCCTGGGGGTGACGACGGGG - Intronic
1202694277 1_KI270712v1_random:112931-112953 TCTTCCTGGCAGCAGCGGCCTGG - Intergenic
925610402 2:5696858-5696880 CCTTCGTTGCGGCGGCCCCGGGG - Exonic
925611642 2:5706591-5706613 CTTTCCTGGGGGTGGCGGCTGGG + Intergenic
927670510 2:25065070-25065092 CCCACCTGGCGGGGGGGGCGGGG + Intronic
932344283 2:70985492-70985514 ATTTCCTGGCGGCGGTGGGGGGG - Intronic
932699858 2:73985085-73985107 CGGTGGTGGCGGCGGCGGCGCGG + Intergenic
933952282 2:87341637-87341659 TCTTCCTGGCAGCAGCGGCCTGG + Intergenic
934031881 2:88055669-88055691 CCTGGCTGGCGGCGTTGGCGGGG - Exonic
934236523 2:90237976-90237998 TCTTCCTGGCAGCAGCGGCCTGG + Intergenic
934766503 2:96882958-96882980 CCTTGCTGGCAGCGGCCGCAGGG - Intronic
938286185 2:130119918-130119940 CCCTCCTGGCGGGGGAGGAGGGG - Intronic
938336827 2:130508638-130508660 CCCTCCTGGCGGGGGAGGAGGGG - Intronic
938352996 2:130611997-130612019 CCCTCCTGGCGGGGGAGGAGGGG + Intronic
938429424 2:131218978-131219000 CCCTCCTGGCGGGGGAGGAGGGG + Intronic
938595543 2:132784006-132784028 CCTGCCTGGAGGGGGCGGAGGGG + Exonic
939203057 2:139063066-139063088 CCTTCCTGGAGGTGGGGGGGGGG + Intergenic
939969668 2:148644974-148644996 CAGCCCGGGCGGCGGCGGCGGGG - Exonic
941020851 2:160407271-160407293 CGGCCCGGGCGGCGGCGGCGAGG + Intronic
945319635 2:208406752-208406774 CCTTCCCGCCGCAGGCGGCGCGG + Intronic
946329677 2:219002147-219002169 CCTTGGTGGCGGGGGCGGAGGGG + Intergenic
947353644 2:229271347-229271369 AGGTCCGGGCGGCGGCGGCGGGG - Intergenic
947566637 2:231198506-231198528 ACTTCCTGGCGGCGGAAGTGAGG - Intergenic
947592933 2:231395585-231395607 CCCGCCAGGCGGCGGCGGGGCGG + Exonic
948824773 2:240568865-240568887 GCGTCTCGGCGGCGGCGGCGGGG - Exonic
1168795811 20:609674-609696 CCGACCTGGCGGCCGCAGCGAGG + Intronic
1171499833 20:25585177-25585199 GTTTCCCGACGGCGGCGGCGCGG - Intronic
1172587139 20:36092796-36092818 CTAACCTGGCGGCGGCGGCGCGG - Intronic
1175871283 20:62210637-62210659 GCTTCCTGCCCGCGGGGGCGAGG + Intergenic
1176173645 20:63707736-63707758 CAGACCTGGCGGCGGCGGCTTGG - Intronic
1176187631 20:63789843-63789865 CCTTCCTGCCGACGTCGGGGTGG - Exonic
1176380695 21:6111021-6111043 CCGCCCGGGCGGCGGGGGCGGGG + Intergenic
1178610434 21:34074159-34074181 CGGACCAGGCGGCGGCGGCGGGG - Intronic
1179742777 21:43427219-43427241 CCGCCCGGGCGGCGGGGGCGGGG - Intergenic
1179783933 21:43719270-43719292 CGGGCCTGGCCGCGGCGGCGCGG - Exonic
1180100160 21:45580110-45580132 CCTTCCTGGTGGCGGGGACTGGG + Intergenic
1180843829 22:18970984-18971006 CCTTCGTGGCCGCGGCGCCGAGG - Intergenic
1181457936 22:23070306-23070328 GCCCCCTGCCGGCGGCGGCGCGG + Intronic
1181532827 22:23526738-23526760 CCTTCCTGGCTGAGGCGGCTGGG - Intergenic
1181546945 22:23607523-23607545 TCTTGCTGGCGGGGGCGGGGGGG + Intergenic
1183349162 22:37325048-37325070 CCCTCCCGGCGGCGGCAGGGAGG - Intergenic
1183455764 22:37922302-37922324 CCTTCCTGGGGGCAGGGGTGGGG - Exonic
1184184663 22:42856865-42856887 CGTTCCCGGGGGCGGCGGCGCGG - Intronic
1184347752 22:43923896-43923918 CGTACATGGCGGCGGCGGCGGGG - Exonic
1185113674 22:48919170-48919192 ACTTCCTGGGGGCCGCGGCCAGG + Intergenic
1185335857 22:50270545-50270567 CCTTCCCGGGGGGGGCGCCGAGG + Intronic
1185413377 22:50697397-50697419 CCTCCCGGGGGTCGGCGGCGAGG + Intergenic
950661149 3:14467779-14467801 GCTTCCTGGAGGAGGCAGCGAGG - Intronic
951528630 3:23678272-23678294 CCTTCCTGGGGGATGGGGCGTGG + Intergenic
951611379 3:24495299-24495321 GATGGCTGGCGGCGGCGGCGGGG - Intergenic
951719799 3:25686859-25686881 CGGTGCTGGCGGCGGCGGCTGGG - Intergenic
954499315 3:50995895-50995917 CCTTTTTGGCGGGGGCGGAGGGG + Intronic
954779129 3:53046206-53046228 CCCTCCTGGCTGGGGCCGCGCGG + Intronic
960684764 3:120285286-120285308 CCTCCCTGGCGCCGCCCGCGTGG + Intergenic
962498633 3:135966499-135966521 CCTCCGCGGCGGCGGCGGCCAGG - Intronic
967469849 3:189848962-189848984 CCTTCCTGGAGGCTGGGGGGTGG - Intronic
968477425 4:818602-818624 CTTTCCTGGCCTCGGCGGTGTGG - Intronic
968642495 4:1721590-1721612 CCTTCCTGGCGGCGGCGGCGCGG + Exonic
968734441 4:2288145-2288167 GCTTCCTGGAGGAGGCGGCCTGG + Intronic
968867901 4:3225526-3225548 CCCTCCTGCCAGTGGCGGCGAGG + Intronic
968965395 4:3766715-3766737 GCTTCCTGGGGGCCGCCGCGCGG + Exonic
969330677 4:6472114-6472136 CCCTCCGGCCGGCCGCGGCGTGG - Intronic
969652814 4:8477907-8477929 CCTTCCAGGAGGCGGCGGCAGGG - Intronic
972162534 4:36244339-36244361 GCTGCCTGGCGGCGGCCGCGCGG + Exonic
972437201 4:39045222-39045244 CCCTCCCGGAGGCGGCTGCGAGG + Intronic
975365698 4:73524944-73524966 CCTTCCTAGCAGCGGCTGCATGG - Intergenic
985780397 5:1867925-1867947 CCTTCACGGCGGGGACGGCGGGG - Intergenic
990320873 5:54628613-54628635 CCTTCCTGGGGGCAGCTGCCTGG - Intergenic
991435852 5:66596612-66596634 CCTCCCGAGCGGCGGGGGCGCGG - Exonic
992484601 5:77182126-77182148 CCTTCCTGGCAGCTGAGGCCAGG - Intergenic
992546254 5:77816873-77816895 CCTTCCTGGCAGTGGCAGAGGGG - Intronic
994094320 5:95835141-95835163 ACTTCCTGGAGGCGGCGGCGAGG - Intergenic
994164623 5:96595902-96595924 GCTTCCTGGAGGAGGTGGCGTGG + Intronic
995787220 5:115842352-115842374 CTTTCCTGGCTGCGCGGGCGAGG + Intronic
996582003 5:125041507-125041529 GCTTGCTGGGGGCGGGGGCGGGG - Intergenic
997990802 5:138543130-138543152 CCTCCCCGGCGGCGGCTCCGCGG + Exonic
998583618 5:143404200-143404222 TCGGCCCGGCGGCGGCGGCGCGG - Intronic
999696245 5:154190668-154190690 CCCTCGTGGCGGCGGCGTGGTGG + Intronic
1001553039 5:172618027-172618049 CCTGCCTGGCGACTGCGGCCCGG + Intergenic
1002190064 5:177473342-177473364 CCTTCCCGGCGGCGGGGCGGCGG + Intronic
1002968148 6:1988454-1988476 CCTTCTTGGCGGTGGGGGCGAGG + Intronic
1004193830 6:13487128-13487150 CCTTCCCGGAGTCGGCGGCAGGG + Exonic
1006319544 6:33312442-33312464 CCCTCCTGGCAGCGGAGGCGGGG - Intronic
1006338643 6:33433685-33433707 TATTCCTGGCCGCGGGGGCGGGG + Intronic
1007398488 6:41590409-41590431 CCTTCCTGGAGGCAGGGGTGTGG - Intronic
1008876268 6:56332581-56332603 CCTTTTTGGCGGGGGCGGGGGGG - Intronic
1008965767 6:57311535-57311557 ACTTCCTAGAGGGGGCGGCGGGG + Intergenic
1011076365 6:83443718-83443740 CATTCCTGGAGGAGGTGGCGTGG + Intergenic
1013177695 6:107691308-107691330 CCTTGCTGTCGGTGGAGGCGGGG - Intergenic
1016657984 6:146543484-146543506 GCCTCCTGGCGGTCGCGGCGCGG - Intergenic
1017672414 6:156779290-156779312 AGTCCCAGGCGGCGGCGGCGGGG + Exonic
1019289265 7:242405-242427 TCTTCCTGGAGGCGGTGGCCAGG + Intronic
1020784451 7:12556411-12556433 CCTCACTGCCGGGGGCGGCGGGG + Intergenic
1022301688 7:29107874-29107896 CCTTCCTGGGGGTGAAGGCGTGG - Intronic
1022348116 7:29538362-29538384 CCTCCCTGGCAGCAGCGGTGTGG + Intergenic
1022358703 7:29639672-29639694 CCTTCCTGGAGGCGGTGGCCTGG + Intergenic
1023810322 7:43906512-43906534 CGTTCCTGCCGGCAGCCGCGGGG + Intronic
1026817142 7:73521930-73521952 CCATCGCGGCGGCGGCGGTGGGG + Exonic
1026882923 7:73919068-73919090 GCTTCCTGGAGGAGGCGGAGTGG + Intergenic
1027774117 7:82443702-82443724 CCTTGATGGCGGCGGAGGCAAGG - Exonic
1029098320 7:98106877-98106899 CCATCATGGCGGCGGGAGCGCGG + Exonic
1032721591 7:134554612-134554634 CCTCCCTGGAGGCGGTGGCCTGG - Intronic
1034219301 7:149431746-149431768 CTGGCCGGGCGGCGGCGGCGGGG + Exonic
1034446046 7:151114881-151114903 CCTGCAGGGCGGCGGCAGCGCGG - Intronic
1034492913 7:151403808-151403830 CCCTCCTGGCGGCAGCAGGGAGG - Intronic
1035021492 7:155803538-155803560 CCTTCTTGGCGCCGTCGTCGCGG + Exonic
1036561930 8:9905665-9905687 CACTGCTGGCGGCGGCGGCCGGG + Intergenic
1042040221 8:64581387-64581409 CCTGGGCGGCGGCGGCGGCGGGG + Exonic
1043464033 8:80487182-80487204 CTTCCGAGGCGGCGGCGGCGGGG + Exonic
1043873903 8:85464022-85464044 CCGATCTGGCGGCGGCGGCTTGG - Exonic
1044692899 8:94896269-94896291 GCGCGCTGGCGGCGGCGGCGGGG - Intronic
1049107886 8:140624987-140625009 CCTTCCTGGAGGAGGCTGCTGGG - Intronic
1049405282 8:142449615-142449637 CCTTCCTGGCGAGGGGGGGGGGG - Exonic
1049462534 8:142736756-142736778 GCTTCCTGGAGGCAGCGGCAAGG - Exonic
1049562109 8:143317085-143317107 GCTTCCTGGAGGAGGCGCCGAGG - Intronic
1049584279 8:143425753-143425775 CCTTCCTGGAGGAGGCTGCCTGG - Intronic
1049724189 8:144137915-144137937 CCTTCCTGGCGCCGGGCGCGCGG + Exonic
1049802872 8:144526383-144526405 CCTTCCTGGGGGAGGCTGAGTGG - Exonic
1052418009 9:28202556-28202578 CCTTTCTGGCGGGGGGGACGGGG - Intronic
1052864302 9:33455794-33455816 CCTTCCTGGCTGCAGGGGCCAGG - Intergenic
1053312370 9:37027726-37027748 CCCTCCGGGCGGGGGCGGGGCGG + Intronic
1054447189 9:65383040-65383062 GCCGCCTGGCGGCGGCAGCGAGG - Intergenic
1056475275 9:86946746-86946768 GCTGCTGGGCGGCGGCGGCGAGG - Exonic
1056747663 9:89318475-89318497 ACTTCCTGGCGTCGCCTGCGGGG + Intergenic
1056765092 9:89440231-89440253 GCTTCCTGGCAGGGGCGGGGAGG - Intronic
1057903776 9:98968792-98968814 CCTGCCTGGGGGCGGGGGCGGGG + Intronic
1060555278 9:124504741-124504763 CCTCGCCGGCGGCGGCGGCGCGG - Intronic
1061987093 9:134136179-134136201 CCTGCCGGGCCGCGGCGGCGGGG - Exonic
1062101906 9:134732914-134732936 CCTGCCTGCCGGCGGCGGGGCGG - Intronic
1062414114 9:136439357-136439379 CCTCCCTTCCGGCGGCTGCGGGG + Exonic
1203773377 EBV:60362-60384 CCCACCTGGCGGCGGCGTCCCGG + Intergenic
1189407117 X:40735355-40735377 CCCGCCCGGAGGCGGCGGCGGGG - Exonic
1190844880 X:54182703-54182725 CTATCCTGGCGGCGACGGCCTGG - Exonic
1192211134 X:69128757-69128779 CGGTGGTGGCGGCGGCGGCGGGG + Intergenic
1193645705 X:84066413-84066435 ACTTGGTGGCGGCGGGGGCGGGG + Intronic
1197602749 X:128548914-128548936 CCTTCCTAGCAGCGGCAGCATGG - Intergenic
1197647015 X:129028545-129028567 CGTTCCTGGCAGCGGAGGGGAGG - Intergenic