ID: 968642639

View in Genome Browser
Species Human (GRCh38)
Location 4:1722041-1722063
Sequence TCCGCCGCAGGCGGCCTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 39}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968642639 Original CRISPR TCCGCCGCAGGCGGCCTAGA TGG (reversed) Intronic
903649512 1:24914301-24914323 GCCGCACCAGGCGGCCAAGAAGG - Intronic
903779255 1:25810966-25810988 TCCGCAGCAGGGGGCACAGAGGG - Intronic
914237317 1:145823882-145823904 TCCGCCGCGGCCGTCCGAGAGGG + Exonic
1077300098 11:1842807-1842829 TCCGCCTCGGGCTGCCTTGAGGG + Intergenic
1080754459 11:35182941-35182963 TCAGTCGCAGCCTGCCTAGATGG - Intronic
1094025895 12:25959107-25959129 GCCCCCGCAGGCCGCCCAGAGGG - Exonic
1102956588 12:117062990-117063012 TCTCCCGCAGGAGGCCTGGAAGG - Intronic
1104093729 12:125537488-125537510 TCCGCCCCAGGTGACTTAGAAGG - Intronic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1141741840 16:85898840-85898862 TCCGCCCGAGCCGGCCTGGAAGG + Exonic
1145298437 17:21613060-21613082 TCAGCAGCAGGAGGACTAGAAGG + Intergenic
1148084830 17:44987827-44987849 TCCGCCGCCGCCGCCGTAGATGG + Intergenic
1151956433 17:77382543-77382565 TCCTCCCCAGGAGGCCTGGAGGG + Intronic
1152540417 17:80971804-80971826 TCCACCGCAGGCGAGCTGGAGGG + Intergenic
1158938261 18:62384590-62384612 TCCGCCTCAGTGGGCCTGGAGGG + Intronic
1165007849 19:32821025-32821047 TCTGCTGGAGGCGTCCTAGACGG - Intronic
1172054542 20:32144996-32145018 TCCGCGACAGGCAGCCTTGAGGG + Intronic
1174373943 20:50113022-50113044 TCCGCTGCAGGAGGCTTTGAGGG + Intronic
1180014649 21:45074407-45074429 TCCGCCGCAGGTGGTCGTGAGGG + Intronic
1181815893 22:25436574-25436596 TCCTCCCCCGGCAGCCTAGAAGG - Intergenic
1184864057 22:47192779-47192801 TCCGGGGCAGGCGGGCAAGAGGG - Intergenic
950550631 3:13663963-13663985 TCGGCCGCAGGCTGCCCCGATGG + Intergenic
961736840 3:129007303-129007325 TCCTCTGCAGTTGGCCTAGAGGG + Intronic
963193890 3:142504748-142504770 GCCGCCGCATCCGGCCTGGAAGG + Intronic
968199924 3:196743559-196743581 GCCACCGCACCCGGCCTAGAAGG - Intronic
968642639 4:1722041-1722063 TCCGCCGCAGGCGGCCTAGATGG - Intronic
984923846 4:184789079-184789101 TCCGCAGGTGGCCGCCTAGAGGG - Intronic
994515033 5:100760390-100760412 GCCGCCGCACCCGGCCAAGAGGG + Intergenic
996383982 5:122890755-122890777 GCCACCGCACCCGGCCTAGAGGG + Intronic
1027189669 7:75989407-75989429 TCCGGAGCAGGCGGCCAGGAAGG - Intronic
1032151779 7:129435042-129435064 CCCGCCGCAGGCAGCCTGGGAGG - Intronic
1035690843 8:1558261-1558283 CCAGTCGCAGGCGGCTTAGATGG + Intronic
1036798033 8:11769883-11769905 ACCTCCGCAGGCGGCTGAGACGG - Exonic
1037818717 8:22125347-22125369 TCCGCAGCAGGCGGCACAGTCGG + Exonic
1044347123 8:91118216-91118238 GCCACCGCACCCGGCCTAGAAGG - Intronic
1057006929 9:91568853-91568875 TCCGCAGCAGGGTGCCTTGAAGG - Intronic
1060548679 9:124475274-124475296 TCCTCCGCAGGCGGGCACGAGGG + Intronic
1192847928 X:74925113-74925135 TCCGCCGCCGCCGCGCTAGATGG + Exonic
1195702570 X:107716276-107716298 TCCCCCACAGCCGGCCTACAAGG + Intronic
1202101593 Y:21314289-21314311 GCCACCGCAGCCGGCCCAGAAGG - Intergenic