ID: 968644481

View in Genome Browser
Species Human (GRCh38)
Location 4:1732731-1732753
Sequence GTCCGGCGTCTCCCTCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968644469_968644481 27 Left 968644469 4:1732681-1732703 CCTGTCACCCTCACGCAGGATCC 0: 1
1: 0
2: 1
3: 10
4: 119
Right 968644481 4:1732731-1732753 GTCCGGCGTCTCCCTCGGGGAGG No data
968644471_968644481 20 Left 968644471 4:1732688-1732710 CCCTCACGCAGGATCCCTGGAAT 0: 1
1: 0
2: 0
3: 6
4: 87
Right 968644481 4:1732731-1732753 GTCCGGCGTCTCCCTCGGGGAGG No data
968644475_968644481 5 Left 968644475 4:1732703-1732725 CCTGGAATCACACAGCACGGCCT 0: 1
1: 0
2: 0
3: 5
4: 121
Right 968644481 4:1732731-1732753 GTCCGGCGTCTCCCTCGGGGAGG No data
968644472_968644481 19 Left 968644472 4:1732689-1732711 CCTCACGCAGGATCCCTGGAATC 0: 1
1: 0
2: 0
3: 5
4: 116
Right 968644481 4:1732731-1732753 GTCCGGCGTCTCCCTCGGGGAGG No data
968644474_968644481 6 Left 968644474 4:1732702-1732724 CCCTGGAATCACACAGCACGGCC 0: 1
1: 0
2: 0
3: 10
4: 109
Right 968644481 4:1732731-1732753 GTCCGGCGTCTCCCTCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968644481 Original CRISPR GTCCGGCGTCTCCCTCGGGG AGG Intronic
No off target data available for this crispr