ID: 968646587

View in Genome Browser
Species Human (GRCh38)
Location 4:1744165-1744187
Sequence GCTCAGCTCCAGAGGGAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 313}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968646576_968646587 1 Left 968646576 4:1744141-1744163 CCCTGCCTGTCCCCAAAGCACAG 0: 1
1: 0
2: 2
3: 45
4: 469
Right 968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG 0: 1
1: 0
2: 1
3: 36
4: 313
968646581_968646587 -9 Left 968646581 4:1744151-1744173 CCCCAAAGCACAGGGCTCAGCTC 0: 1
1: 0
2: 2
3: 25
4: 309
Right 968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG 0: 1
1: 0
2: 1
3: 36
4: 313
968646575_968646587 2 Left 968646575 4:1744140-1744162 CCCCTGCCTGTCCCCAAAGCACA 0: 1
1: 0
2: 2
3: 38
4: 455
Right 968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG 0: 1
1: 0
2: 1
3: 36
4: 313
968646582_968646587 -10 Left 968646582 4:1744152-1744174 CCCAAAGCACAGGGCTCAGCTCC 0: 1
1: 0
2: 1
3: 34
4: 293
Right 968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG 0: 1
1: 0
2: 1
3: 36
4: 313
968646574_968646587 5 Left 968646574 4:1744137-1744159 CCTCCCCTGCCTGTCCCCAAAGC 0: 1
1: 1
2: 3
3: 84
4: 752
Right 968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG 0: 1
1: 0
2: 1
3: 36
4: 313
968646580_968646587 -4 Left 968646580 4:1744146-1744168 CCTGTCCCCAAAGCACAGGGCTC 0: 1
1: 0
2: 3
3: 20
4: 298
Right 968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG 0: 1
1: 0
2: 1
3: 36
4: 313
968646577_968646587 0 Left 968646577 4:1744142-1744164 CCTGCCTGTCCCCAAAGCACAGG 0: 1
1: 1
2: 5
3: 57
4: 401
Right 968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG 0: 1
1: 0
2: 1
3: 36
4: 313
968646573_968646587 13 Left 968646573 4:1744129-1744151 CCTGCTGGCCTCCCCTGCCTGTC 0: 1
1: 0
2: 9
3: 90
4: 568
Right 968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG 0: 1
1: 0
2: 1
3: 36
4: 313
968646572_968646587 23 Left 968646572 4:1744119-1744141 CCATGTGGCTCCTGCTGGCCTCC 0: 1
1: 0
2: 5
3: 75
4: 766
Right 968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG 0: 1
1: 0
2: 1
3: 36
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968646587 Original CRISPR GCTCAGCTCCAGAGGGAGAC GGG Intronic
900031131 1:373875-373897 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051698 1:602124-602146 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
900539186 1:3194326-3194348 GCTCAGCTCCAGGGTGAAAGGGG - Intronic
900628501 1:3621094-3621116 GCACAGCATCACAGGGAGACAGG + Intergenic
900928247 1:5719478-5719500 CCCCAGCTCTAGAAGGAGACAGG + Intergenic
901041000 1:6363452-6363474 GCACAGCATCACAGGGAGACAGG - Intronic
901861885 1:12079640-12079662 GCTCAGCTCCACATGGAAAATGG + Intronic
902511700 1:16970208-16970230 GCTCAGGCCCAGAGGGATTCGGG + Intronic
902990466 1:20184055-20184077 GCCCAGCCCCAGGGGGAGGCAGG - Intergenic
903165709 1:21519049-21519071 GCTCAGATCCAGTGGGACACAGG + Intronic
904304271 1:29577522-29577544 GCGCAGCCCCAGAGGGAGGCGGG - Intergenic
906308685 1:44738072-44738094 GCTTGGCATCAGAGGGAGACCGG - Intergenic
906322571 1:44826379-44826401 GACCAGCACCTGAGGGAGACAGG + Exonic
906322737 1:44827077-44827099 GGTCAGCTGCAGAGGCAGAGAGG + Exonic
907273773 1:53305777-53305799 CCTCAGCCCCACAGGGAGCCAGG + Intronic
908654402 1:66372681-66372703 GTTCATCTCCACAGGGAGAGGGG - Exonic
910448188 1:87319958-87319980 GCTCTGCTAGAGAGGGAGATTGG + Intergenic
910966882 1:92816749-92816771 GCTCTGCCCCTGATGGAGACAGG + Intergenic
911534154 1:99079420-99079442 GCTCGGCATCAGAGGGAGACCGG + Intergenic
913078931 1:115364122-115364144 GCTCAGATCAAAAGGGACACAGG - Intergenic
915120875 1:153628957-153628979 GCTCAGGTCCCGGGGGAGTCTGG + Intronic
915469121 1:156115217-156115239 GCTCAGCTCCAGCTGCAGGCGGG - Exonic
915556047 1:156661371-156661393 GGAGAGCTCCAGAGGTAGACAGG + Intergenic
918142456 1:181731084-181731106 GCAGATTTCCAGAGGGAGACAGG - Intronic
919767785 1:201138501-201138523 GCCCAGCCTCAGAGGGAGAGGGG - Intronic
920312128 1:205054678-205054700 CCAGAGCTCCAGAGAGAGACAGG + Intronic
920738960 1:208561890-208561912 GCTCAGCTCCATATGCAGAGAGG + Intergenic
921638590 1:217524827-217524849 GCTTGGCATCAGAGGGAGACCGG + Intronic
922421715 1:225464996-225465018 GTTCAGCTGCAGAGGGAGGCTGG + Intergenic
922427947 1:225517301-225517323 GGGCAGCTGCAGAGGGAGAAGGG + Exonic
923624429 1:235602410-235602432 GCTCAGCTCCAGGGGGAATTTGG - Intronic
924176109 1:241392776-241392798 GCTGAGTTCCAGAGGCAGACAGG + Intergenic
924795922 1:247292067-247292089 CCTCAGCTCCAGGTGGAGCCTGG - Intergenic
1063034947 10:2277242-2277264 GCTGAGCTCCAGGAGGAGCCGGG - Intergenic
1064399799 10:15012037-15012059 CCTCATCTCCAGAGGAAGAGGGG + Intergenic
1064944247 10:20770543-20770565 GCTCAGCTCCAGAGCTAGACTGG - Intergenic
1066269145 10:33805150-33805172 TCTCAGCACCAATGGGAGACAGG + Intergenic
1066963655 10:42242494-42242516 GGTCAGCTCCAGAGGGCGCGAGG - Intergenic
1067044124 10:42974950-42974972 CCTCAGGTCCAGTGGGAGAGGGG + Intergenic
1067057450 10:43060615-43060637 GATCTGCTCCAGAGTGACACTGG - Intergenic
1067282842 10:44885949-44885971 GCTCAGGACTAGAGGGAGGCAGG - Intergenic
1068759478 10:60691783-60691805 GCTCAGCTCTTGAGGGAAAGAGG - Intronic
1069534263 10:69241412-69241434 GCTTATCCCCTGAGGGAGACTGG + Intronic
1069741617 10:70688823-70688845 GCTCCGCATGAGAGGGAGACCGG + Intronic
1069915504 10:71784408-71784430 ACTCAGCTCCACAGTGAGTCTGG + Intronic
1070761657 10:79027865-79027887 GCTCAGCTTCTGAGGCAGGCAGG - Intergenic
1070835105 10:79443092-79443114 GCTAAGGCCCAGAGAGAGACGGG + Intronic
1072504893 10:96055910-96055932 TCTCAATTCCAGAGAGAGACTGG - Intronic
1072722435 10:97789219-97789241 GCCCAGCCCCTGAGGGAGCCTGG - Intergenic
1074548038 10:114417022-114417044 TTACAGCCCCAGAGGGAGACAGG + Intergenic
1075462922 10:122630739-122630761 CCTCACCTCCAGACGGAGAGGGG - Intronic
1076629529 10:131843885-131843907 CCCCAGCTCCAGAGAGAGAAAGG + Intergenic
1076811990 10:132891360-132891382 CCTGAGCTCCAAAGGGAGAGGGG - Intronic
1076931309 10:133533665-133533687 TCCCAGCTCCACAGGGACACAGG - Intronic
1077282693 11:1752831-1752853 GGTCAGCTGCAGAGGAAGGCTGG + Exonic
1077599474 11:3563993-3564015 ACTCAGCGCCAGAGCCAGACTGG + Intergenic
1077674860 11:4187095-4187117 GCTGGGCGCCAGAGGGCGACTGG + Intergenic
1079328428 11:19513936-19513958 CCTGAGCTCCAGAGGGAGCATGG + Intronic
1080336474 11:31203346-31203368 GCTCAGTTCTAGGGGGTGACTGG - Intronic
1081538832 11:44015414-44015436 ACTCTCCTCCAGTGGGAGACAGG + Intergenic
1083730198 11:64648663-64648685 GGCCAGCTGCAGAGGCAGACCGG - Intronic
1083910575 11:65706788-65706810 GCACAGCATCACAGGGAGACAGG - Intergenic
1083999064 11:66286260-66286282 GCTCAGAGCCAGTGGGAGCCGGG + Intronic
1084217711 11:67659367-67659389 GCACAGCATCACAGGGAGACAGG + Intergenic
1084273281 11:68039941-68039963 GCACAGCCCCAAAGGGAGCCAGG + Intronic
1086860842 11:91923279-91923301 GGTCATCTCCAGGGGGTGACTGG - Intergenic
1086911123 11:92473963-92473985 TCTCAGCTCCATAGGAAGGCTGG - Intronic
1086916102 11:92531671-92531693 GCTGAGCCCCAGAGGAAGGCTGG - Intronic
1087317056 11:96615130-96615152 GCTGAGCTCCCCAGGGAGACGGG - Intergenic
1089398265 11:118149797-118149819 GATCAGCATGAGAGGGAGACTGG - Intronic
1090551385 11:127823935-127823957 GCTCAGCTACTGAGGGAGTCAGG + Intergenic
1091331046 11:134731016-134731038 GCACAGCCCCAGACTGAGACAGG - Intergenic
1091586042 12:1817513-1817535 GCTCGGCATCAGAGGGAGACCGG - Intronic
1092032918 12:5304431-5304453 GATCACCTTCAGAGGGTGACAGG + Intergenic
1092320199 12:7464146-7464168 GCCCAGCACCAGAGGGATAGAGG - Intronic
1092487538 12:8914947-8914969 GCTCAGCGCCGGAGGTAGGCAGG - Intronic
1095905395 12:47372139-47372161 GCGCAAGTCCAGAAGGAGACTGG + Intergenic
1095905923 12:47377908-47377930 GCTGAGCTCCAGGGAGAGCCAGG + Intergenic
1096506843 12:52099080-52099102 CCTCATATCCAGAGGGAGAGAGG - Intergenic
1096556753 12:52408573-52408595 GCTGAGCCCCAGAAGGACACAGG - Intergenic
1096832503 12:54325239-54325261 GTTCAGCCCGAGTGGGAGACGGG + Intronic
1097087235 12:56477567-56477589 GTTCAGCTCTCCAGGGAGACTGG - Exonic
1099589916 12:84574478-84574500 CCCCAGCTCCACAGGGACACTGG + Intergenic
1101647639 12:106645915-106645937 CCTCAGCTACAGATGGAGAAAGG + Intronic
1102459346 12:113090605-113090627 ACACAGCTCCCGAGGGAGGCAGG - Intronic
1102975508 12:117204360-117204382 GCTCTGCCCCAGAGGCAGCCGGG - Intergenic
1104398525 12:128456119-128456141 GCCCTGCACCAGAGGGAGAATGG + Intronic
1104678050 12:130729231-130729253 TCTCACCTGCAGAGGGAGACCGG - Intergenic
1104753056 12:131252000-131252022 GCTCAGCCCCAGTGGGAGTCAGG + Intergenic
1104871850 12:132005060-132005082 GCTCAGCTGCAGAGGGTTGCGGG - Exonic
1105706536 13:22970990-22971012 GCTCAGCCTCAGAGGTGGACAGG + Intergenic
1106467058 13:30022928-30022950 GATCAGATACAGAGGGTGACCGG - Intergenic
1106679983 13:31999509-31999531 GCTCGGCATCAGAGGGAGACTGG - Intergenic
1107737879 13:43417181-43417203 CCTCAGCAACAGAGGGAGACGGG + Intronic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1113481543 13:110625513-110625535 GCCCAGCTCCAGAGGCAGGGAGG + Intronic
1113676942 13:112214126-112214148 CCTTAGCTCCACAGGGAGATGGG + Intergenic
1116019249 14:39441312-39441334 GATGAACTCAAGAGGGAGACCGG + Intergenic
1122133602 14:99620217-99620239 CCTCAGCTCCCCAGGGAGTCAGG + Intergenic
1122519804 14:102335364-102335386 TGTCAGCTCCAGAGGGAGTGTGG - Intronic
1122849887 14:104522465-104522487 GCTCAGCCTCAGAGGTGGACAGG + Intronic
1202890124 14_KI270722v1_random:148763-148785 GCACAGCATCACAGGGAGACAGG + Intergenic
1125592429 15:40863154-40863176 ACCCAGCACCAGATGGAGACTGG + Intergenic
1128210279 15:65894625-65894647 GCTCAGCTCCAGAGGCACAAAGG - Intergenic
1128806701 15:70536403-70536425 GCTCATTCCTAGAGGGAGACAGG + Intergenic
1129194006 15:73953552-73953574 GTCCAGCTCCAGAGGGAGAGTGG - Intergenic
1129923267 15:79339008-79339030 GCACAGCATCACAGGGAGACAGG - Intronic
1130632054 15:85579439-85579461 GTTCACCTCCAGAGGAATACTGG - Exonic
1130819547 15:87479919-87479941 GCTCAGCTACAGAAGGAGCAGGG - Intergenic
1132495890 16:263253-263275 GCACTGCTCCAGAGCTAGACAGG - Exonic
1133240072 16:4408990-4409012 GCTCAGCTCCAGAGGTGGGGAGG + Intronic
1133328808 16:4958481-4958503 GCTCAGCTCCCGAGCCAGGCGGG + Intronic
1133395294 16:5442304-5442326 GCGGAGCTGCAGAGGGAGCCAGG + Intergenic
1133413392 16:5587038-5587060 TCTCAGCCCCAGAGGGAGCCAGG + Intergenic
1133977727 16:10612046-10612068 CCTCTGCTCCTGAGGGAGACGGG - Intergenic
1134187591 16:12096910-12096932 GCTGAGGTCCAGAGGGTCACAGG + Intronic
1134880885 16:17744942-17744964 GCTGAGTGCCAAAGGGAGACTGG + Intergenic
1135938112 16:26798183-26798205 GCTCATCTCTACAGGGAGGCAGG - Intergenic
1136474896 16:30506744-30506766 GCTCAGCTCCACAGAGAGGCTGG - Exonic
1136607274 16:31344821-31344843 GCTGAGCTACAGAGGAAGCCAGG - Intergenic
1139558478 16:67727497-67727519 CCGTGGCTCCAGAGGGAGACAGG + Intronic
1140408728 16:74728351-74728373 GCTGAGATCCAGAGGCAGAATGG + Intronic
1140998280 16:80282744-80282766 GCACAAGTCCAGCGGGAGACGGG - Intergenic
1141552514 16:84815623-84815645 GCCTGGCTGCAGAGGGAGACGGG + Intergenic
1142137067 16:88456294-88456316 TGTCACCTCCAGAGGGAGAGAGG + Intronic
1142172809 16:88631668-88631690 TCTCAGCTCAGGAGGGAGCCTGG - Exonic
1144810104 17:17993603-17993625 GCTGAGCTCCAGAGGGAACCAGG + Intronic
1145279662 17:21458131-21458153 GCACAGGAGCAGAGGGAGACTGG + Intergenic
1145844825 17:28029452-28029474 GCTCAACTCCATGGGGAAACTGG - Intergenic
1146955293 17:36933634-36933656 GATCAGCCCCAGAGGGACCCTGG - Intergenic
1146970375 17:37067029-37067051 GCTCAACCCTCGAGGGAGACTGG + Intergenic
1147659214 17:42108229-42108251 TGTGAGCTCCAGAGGGAGGCCGG + Intronic
1148210748 17:45807011-45807033 GTTCAGCCCCAGAAGGAGAAGGG - Exonic
1150645485 17:66975172-66975194 GCCCAGCTCCAGACAGAGCCTGG + Intronic
1151757208 17:76081795-76081817 GCTGAGCACCAGTGGGTGACCGG - Intronic
1151799175 17:76367502-76367524 CCTGAGCTACAGAGCGAGACTGG - Intronic
1152302471 17:79503314-79503336 GCTCCGGGGCAGAGGGAGACTGG - Intronic
1152827243 17:82474846-82474868 TCTCAGCTCCAGATGGGGACAGG + Intronic
1153817012 18:8799272-8799294 GCTCAGATCCAGATGAGGACAGG + Intronic
1153904951 18:9652997-9653019 GGTCAGAGGCAGAGGGAGACTGG - Intergenic
1155078448 18:22383867-22383889 GATCTGGTTCAGAGGGAGACAGG - Intergenic
1155144666 18:23073214-23073236 ACCCAGCTACTGAGGGAGACGGG + Intergenic
1157544755 18:48539653-48539675 GCGCAGCTCCAAAGCGAGCCGGG - Intronic
1157711465 18:49852630-49852652 GTTCAGCTCCAGAAGGTGATCGG + Intronic
1161074514 19:2278857-2278879 GGTCAGCTCTGCAGGGAGACAGG + Exonic
1161222191 19:3122910-3122932 GATCAGCCCCATGGGGAGACGGG + Exonic
1161313252 19:3606585-3606607 GCTCAGCTCCAGACGGCGCCCGG - Exonic
1161984402 19:7645725-7645747 GCACAGGGCCAGAGAGAGACAGG - Intronic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1162725547 19:12688103-12688125 GAGCAGCTCCAGATGGAGGCAGG + Intronic
1163075653 19:14888824-14888846 GCACAGCATCACAGGGAGACAGG + Intergenic
1163242936 19:16075622-16075644 GGTCAGAACCAGAGGGAGAAAGG + Intronic
1164084645 19:21889975-21889997 GCACAGCATCACAGGGAGACAGG + Intergenic
1165764615 19:38343039-38343061 GCCCACCTCAAGAGTGAGACTGG + Intronic
1166485762 19:43210735-43210757 GCACAGCATCACAGGGAGACAGG + Intergenic
1166885965 19:45961051-45961073 GTGCAGCTGCAGAAGGAGACCGG - Exonic
1166915012 19:46189380-46189402 GCACAGCATCACAGGGAGACAGG + Intergenic
1167523181 19:49969163-49969185 TCCCAGCTCCACAGGGAGAAGGG - Intergenic
1167533752 19:50035839-50035861 GCTCAGCTTTAGAGTCAGACAGG - Intronic
1167979116 19:53258121-53258143 GCACAGCATCACAGGGAGACAGG - Intergenic
1168303109 19:55418256-55418278 GTTCAGCTCCAGAGGCACAGAGG - Intergenic
1202665544 1_KI270708v1_random:115595-115617 GCACAGCATCACAGGGAGACAGG + Intergenic
926333142 2:11841916-11841938 GCTCAAGTCCAGAGGCAGTCAGG + Intergenic
927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG + Intronic
928183103 2:29083694-29083716 GGTCAGCACTAGAGGTAGACTGG - Intergenic
928542364 2:32295033-32295055 GCTCGGCATCAGAGGGAGAGGGG + Intronic
929516434 2:42607035-42607057 GCTCCGCATGAGAGGGAGACCGG + Intronic
930029825 2:47051651-47051673 GCCCAGCACCATGGGGAGACAGG - Intronic
930187043 2:48420636-48420658 GCTAAGCCCCAGGGGAAGACAGG + Intergenic
932331418 2:70900418-70900440 GCTCCGCGCCAGGGGGAGAGGGG - Intergenic
932672991 2:73754288-73754310 GCACAGCATCACAGGGAGACAGG - Intergenic
932847923 2:75154174-75154196 GTTCAGATCCCGAGGGAGCCAGG - Intronic
934768933 2:96895770-96895792 GCTAAGCTCAAGAGGGGGGCTGG - Intronic
934912827 2:98274967-98274989 CCTCTGCTCCTCAGGGAGACAGG + Intronic
936069178 2:109353902-109353924 TCTGAACTCCAGAGGGAGGCAGG - Intronic
936113026 2:109680627-109680649 GCTCAGCGCCAGGGGAAAACAGG - Intergenic
936157530 2:110058191-110058213 CCTCAGCACCAGTGAGAGACAGG - Intergenic
936187162 2:110313253-110313275 CCTCAGCACCAGTGAGAGACAGG + Intergenic
936715633 2:115183947-115183969 GCAGAGCTCCTGGGGGAGACAGG + Intronic
937213826 2:120297602-120297624 GCTCAGCTCGACAGTGAGCCAGG - Intergenic
937309647 2:120894166-120894188 GCTGAGCTCCAGGGTGAGATTGG - Intronic
938244941 2:129769093-129769115 GCTCACCTGCAGAGGCTGACGGG - Intergenic
938595695 2:132785120-132785142 CCTCAGGTACAGAGGGAGAGGGG - Exonic
939345727 2:140964295-140964317 GCACAGCATCACAGGGAGACAGG + Intronic
941820532 2:169840245-169840267 GCTCAGGCCCAGAGGGAGGTGGG - Intronic
941879515 2:170466625-170466647 GCTCCGCTCCACAGGGATTCTGG + Exonic
942708490 2:178804222-178804244 GCTCAGCTGCAGAGCCAGACTGG - Intronic
944722800 2:202440763-202440785 GCTTGGCATCAGAGGGAGACCGG + Intronic
946768287 2:223060584-223060606 GCTCAGCTCCAGCGCCAGAGTGG + Intronic
947801063 2:232928608-232928630 TCTCTGCTCCAGGCGGAGACTGG + Intronic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
1168888180 20:1274969-1274991 GTGCAGCCCCAGAGGGAGAAGGG + Intronic
1168895472 20:1320737-1320759 GCACTGCTCCAGAGGGAGGAGGG + Intronic
1173342024 20:42161457-42161479 GCTCATCTCCACAGGGTCACAGG + Exonic
1173554814 20:43958559-43958581 GCTCAGGTCCATAGGGAAAATGG - Intronic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1173658761 20:44718753-44718775 ACTGAGCTCCAGAGAGGGACAGG - Intronic
1173727663 20:45308486-45308508 ATTCAGCTACAGCGGGAGACTGG + Intronic
1175921119 20:62451041-62451063 AGTCAGCTCCCCAGGGAGACAGG - Intergenic
1176258452 20:64166237-64166259 GAACAGCTACCGAGGGAGACAGG - Intronic
1176364323 21:6023478-6023500 GCTCTGCTCCAGTGGAAGCCAGG + Intergenic
1176613802 21:9011120-9011142 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1179759195 21:43515067-43515089 GCTCTGCTCCAGTGGAAGCCAGG - Intergenic
1180048036 21:45318682-45318704 GCCCAGCTCCAGGGTGAGGCCGG + Intergenic
1180200984 21:46224027-46224049 GCACAGCATCACAGGGAGACAGG - Intronic
1180332257 22:11492515-11492537 GCACAGCATCACAGGGAGACAGG + Intergenic
1180831567 22:18909638-18909660 ACACAGCACCAGAGGGAGAAGGG - Intronic
1181068285 22:20316750-20316772 GCACAGCGCCAGAGGGAGAAGGG + Intronic
1181921801 22:26326697-26326719 GCTCAGCTCTCAAGGGAGGCTGG - Intronic
1182540406 22:31037458-31037480 GCCCAGCTTCAGAGCAAGACAGG + Intergenic
1182756899 22:32687653-32687675 GGTGAGCTCAAGAGGGAGGCGGG - Intronic
1183929227 22:41226624-41226646 GCTCAGATGCAGAGGGAGAGGGG - Intronic
1184047300 22:41979439-41979461 GCTCAGCTGCAGAGGCATAAGGG + Intronic
1184145335 22:42607141-42607163 GCTCGGCATCAGAGGGAAACTGG - Intronic
1184275220 22:43405999-43406021 GCTCAGCTGGAGGGGGTGACTGG + Intergenic
1184650468 22:45917275-45917297 GCTCAGACTCAGAGGGAAACAGG + Intergenic
1184756114 22:46516884-46516906 GGTCAGCTGCAGTGGGAAACGGG - Intronic
1184916821 22:47575036-47575058 CCTCAGCTCCAGAGGAAGGAGGG - Intergenic
1203281651 22_KI270734v1_random:134909-134931 ACACAGCACCAGAGGGAGAAGGG - Intergenic
949374002 3:3366692-3366714 GCTCAGCCACAGAGGGCTACTGG + Intergenic
949884908 3:8685054-8685076 CCTCATATCCAGAGGGAGAGAGG - Intronic
950060663 3:10069491-10069513 GCTCGGCATCAGAGGGAGACGGG - Intronic
950553451 3:13681441-13681463 GCTGAGCTCAGGAGGGAGGCTGG + Intergenic
952332455 3:32376764-32376786 GCTGAGCTCCAGAGGGAAGACGG - Intergenic
953792697 3:45960327-45960349 ACTCAGGTCCTGAGAGAGACAGG + Intronic
954601806 3:51876187-51876209 GCTCAGGGACAGAGGAAGACAGG - Intergenic
954945953 3:54424604-54424626 GCTGAGCTGCAGATGGAGCCAGG + Intronic
954993443 3:54860743-54860765 GCTCTGCTCCATAGAGAAACAGG - Intronic
955406583 3:58629540-58629562 GCCCAGCCACAGAGTGAGACAGG - Intergenic
957090362 3:75723911-75723933 GCACAGCATCACAGGGAGACAGG - Intronic
958483703 3:94676793-94676815 GCTCTGTTCCAGAGGGGCACTGG - Intergenic
961372150 3:126438078-126438100 GCTCAGATCCAACGGGACACGGG + Exonic
961543897 3:127618814-127618836 GCTCATCTCCACAAGGGGACAGG - Intronic
961869646 3:129978034-129978056 GCTCTGCTGCAGAGGGAATCAGG + Intergenic
963892745 3:150653936-150653958 GCTCAACTCCAGAGAAAGCCAGG + Intergenic
964588655 3:158336433-158336455 CCCCAGCTCCAGAGGGTCACTGG + Intronic
964682761 3:159360627-159360649 GCTCAGATTCAGTGGGAGACAGG + Intronic
965439786 3:168698855-168698877 GCACAGCATCACAGGGAGACAGG + Intergenic
967888912 3:194351273-194351295 TCTCTGCTCCTGAGGAAGACAGG - Exonic
968548345 4:1210021-1210043 TCCCAGCTCCAGCTGGAGACAGG - Intergenic
968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG + Intronic
969236330 4:5867609-5867631 TCTCAGCTCCAGAGGGGACCAGG + Intronic
971146616 4:23983793-23983815 GGTTAGCTAAAGAGGGAGACAGG - Intergenic
975377810 4:73665895-73665917 GCACAGCATCACAGGGAGACAGG + Intergenic
975484560 4:74920485-74920507 GCTCAGCTCCATAGTGAAAAAGG + Intergenic
979962502 4:127037159-127037181 GCTCAGCCCCAGTGGGATAAGGG - Intergenic
981501053 4:145452305-145452327 TCAGAGCTCCAGAGGGACACTGG + Intergenic
984580146 4:181501877-181501899 GCTCAGCTACAGGGCGAGCCGGG + Intergenic
984710504 4:182880298-182880320 GCACAGCTCTAGAGGTAGAACGG - Intergenic
985613304 5:903032-903054 GCACAGCATCACAGGGAGACAGG + Intronic
985871925 5:2564043-2564065 GCTGAGCTCCAGGTGGAGACAGG - Intergenic
987750972 5:22038345-22038367 GCTCAGCCCCCTAGGGAGAGAGG - Intronic
988875691 5:35443719-35443741 CCTGGGCTCAAGAGGGAGACTGG - Intergenic
990522800 5:56595834-56595856 CCACAGCTCCAGAGGCAGCCTGG + Intronic
994690830 5:103017696-103017718 GCTTAGTTCCAGAAGGAGAGAGG + Intronic
998258751 5:140611437-140611459 GCTCAGGCACAGAGGGAGAGGGG - Intergenic
998291271 5:140916818-140916840 GCTCAGAACCAGAGGGATAGGGG - Intronic
998343850 5:141443082-141443104 GTTCAGCTTGAGAAGGAGACTGG - Intronic
998805145 5:145911417-145911439 GCTCTGCCACAGAGGGAGAAGGG + Intergenic
999231462 5:150064671-150064693 GCCCAGCTGCAGAGGGACAGAGG - Intronic
1001092801 5:168753817-168753839 GCCAAGACCCAGAGGGAGACGGG - Intronic
1001658839 5:173375204-173375226 GCTCAGGTGCAGAGGGACACAGG - Intergenic
1002086712 5:176780488-176780510 GCTCAGAGCCAGAGAGAGAAGGG - Intergenic
1002429298 5:179193868-179193890 ACTCAGCTCCAGGGGCAGCCTGG + Intronic
1002742689 5:181444993-181445015 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1003924507 6:10864275-10864297 GCCCAGCTGCAGAGGCAGAGGGG - Intronic
1004673006 6:17815284-17815306 GCACAGCATCACAGGGAGACAGG + Intronic
1007250893 6:40494150-40494172 TCTCAGGTCCAGGGGGAGACAGG + Intronic
1009923499 6:70092300-70092322 CCTCCACTCCAGAGGGAAACTGG + Intronic
1010110031 6:72216392-72216414 GCTCATCTCCAGAGGGCAAAAGG - Intronic
1013460755 6:110372831-110372853 GCTCAGATGCTGAGGGAAACAGG - Intergenic
1013530947 6:111018179-111018201 GCTCGGCATCAGGGGGAGACCGG + Intronic
1015144618 6:129971835-129971857 TCTTTGCTCCAGAGGGAGACAGG - Intergenic
1016414899 6:143821983-143822005 GGGGAGCTCCAGAGGGGGACAGG - Intronic
1016646227 6:146411613-146411635 CCTGAGCTCCAGGAGGAGACTGG + Intronic
1017740368 6:157400851-157400873 GCACAGCTGCACAGGGAGCCCGG - Intronic
1017981756 6:159406772-159406794 GCTTGGCATCAGAGGGAGACCGG - Intergenic
1018093978 6:160368534-160368556 GCTCAGCTGCAGAGGAACACAGG - Intronic
1018174679 6:161168311-161168333 GCACAACTCCACAGGGAGTCAGG + Intronic
1018947109 6:168355770-168355792 GGTCAGCTCCAGAGAGATGCAGG - Intergenic
1019247824 6:170720732-170720754 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019449724 7:1091161-1091183 GCTCAGCTGCAGCTGGAGGCTGG - Intronic
1019705292 7:2494547-2494569 GCTCACATCCAGAGGGGGAAGGG + Intergenic
1019841422 7:3450012-3450034 GCTGCGCTCCAGAGGAAGAAAGG + Intronic
1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG + Intergenic
1022508275 7:30920308-30920330 GCTCAGATACAGAGGGACAGGGG + Intronic
1022564543 7:31384845-31384867 GCTCCCGTGCAGAGGGAGACAGG - Intergenic
1023060961 7:36326395-36326417 GGTCAGCTCCAACTGGAGACTGG - Exonic
1023301405 7:38776038-38776060 CCTCAGCTTCAAAGGGAGACTGG + Intronic
1023841858 7:44102625-44102647 GCTCAGGTGCACAGGGAGCCTGG + Intergenic
1024242247 7:47444640-47444662 CCTCAGCTGCAGAGTGAGAAGGG + Intronic
1024587653 7:50855513-50855535 GCTCTGCTGCAGAGTGAGGCTGG - Intergenic
1025775002 7:64553615-64553637 GCTTGGCATCAGAGGGAGACAGG - Intronic
1027140637 7:75654586-75654608 GCTCGGCTTCAGAGTGAGAGAGG + Intronic
1027193282 7:76010542-76010564 CCTCAGCCCCAGAAGGAGCCAGG + Intronic
1027201403 7:76066075-76066097 GCTCAGAGCCAGAGGGTGCCAGG - Intronic
1029364104 7:100106399-100106421 GCTCAGCTCCTGAGACAGGCTGG - Exonic
1029404557 7:100366784-100366806 GCTCAGCGATAGAGGGAGCCAGG + Intronic
1029983456 7:104900567-104900589 TGTCAGATCCAAAGGGAGACAGG + Intronic
1032544006 7:132727084-132727106 GCTCAGGTCCTGCGGGAGAGGGG - Intronic
1034401170 7:150862587-150862609 CCTCAGCTCCAGAGGGAGGGAGG - Intergenic
1034489783 7:151387065-151387087 GGTCAGCTCCAGAGCCAGCCAGG + Intronic
1035500293 8:87132-87154 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
1035603385 8:912622-912644 GCTCAGCTCCACAGAGAGGAAGG - Intergenic
1036240146 8:7074373-7074395 CCTAATCTCCAGAGGGAGAGAGG - Intergenic
1036240159 8:7074448-7074470 CCTCACATCCAGAGGGAGAGAGG - Intergenic
1036590913 8:10167198-10167220 ACTCAGCTGCAGTGGGAGCCCGG - Intronic
1038167720 8:25101797-25101819 GTAGAGCTCCAGTGGGAGACGGG - Intergenic
1038292460 8:26262146-26262168 TCTCAGCGCCAGAGGGATGCAGG + Intergenic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1042133854 8:65616162-65616184 GCTCGGCATCAGAGGGAGACCGG - Intronic
1042228875 8:66537160-66537182 GGTCAGCTCCTGAGGGAGGGAGG + Intergenic
1045326121 8:101119006-101119028 GCTCATCTCCCCAGGGAGGCTGG + Intergenic
1045397527 8:101775678-101775700 GCTCAGATCCAGATGGAGGTTGG + Intronic
1049468969 8:142766891-142766913 GCACAGCTCAAGAGGAAGCCAGG - Intronic
1049796133 8:144498074-144498096 TCTCTGCTCCGGAGGGAGGCAGG - Intronic
1049880038 8:145055649-145055671 GCACAGCATCACAGGGAGACAGG - Exonic
1052834790 9:33242248-33242270 GCTCAGGTGCATAGGGAGGCGGG + Intronic
1053011779 9:34637719-34637741 GCGCAGCTCAGGAGGGAGCCGGG + Exonic
1053648378 9:40138460-40138482 GGTGAGTTGCAGAGGGAGACTGG + Intergenic
1053667528 9:40326489-40326511 GCTCTGCTCCAGGTGGAGAAGGG + Intronic
1053757360 9:41325381-41325403 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1053917109 9:42951592-42951614 GCTCTGCTCCAGGTGGAGAAGGG + Intergenic
1054329356 9:63736403-63736425 GGTGAGTTGCAGAGGGAGACTGG + Intergenic
1054378670 9:64466516-64466538 GCTCTGCTCCAGGTGGAGAAGGG + Intergenic
1054517083 9:66049796-66049818 GCTCTGCTCCAGGTGGAGAAGGG - Intergenic
1054536202 9:66237710-66237732 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1055241922 9:74196874-74196896 GCTGGGCATCAGAGGGAGACGGG - Intergenic
1056409431 9:86311649-86311671 GCTCGGCATCAGAGGGAGACCGG - Intronic
1056445266 9:86659571-86659593 GCTCAACCACAGAGGGGGACAGG - Intergenic
1056524308 9:87428745-87428767 GATCAGCTCAGGAGGGAGAATGG + Intergenic
1056796295 9:89660949-89660971 GGTGACCTCCAGAGGGAGAAGGG + Intergenic
1057309542 9:93933474-93933496 GCTCACACCCAGAGGGAGCCTGG + Intergenic
1058119160 9:101119441-101119463 CATCACCTCCAGAGGGACACTGG - Intronic
1058851059 9:109012933-109012955 GCCCAGCTCCCGAGGCAGAGAGG - Intronic
1060686885 9:125622836-125622858 GCTCCGCATGAGAGGGAGACTGG - Intronic
1061039203 9:128129918-128129940 GCACAGCATCACAGGGAGACAGG + Intergenic
1203487214 Un_GL000224v1:67930-67952 GCACAGCATCACAGGGAGACAGG + Intergenic
1203499835 Un_KI270741v1:9830-9852 GCACAGCATCACAGGGAGACAGG + Intergenic
1203608596 Un_KI270748v1:76212-76234 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1187927499 X:24263384-24263406 GTACAGCTCAGGAGGGAGACAGG - Intergenic
1189546527 X:42047970-42047992 GCTCAGAACCAGACGGAGAAAGG - Intergenic
1190122746 X:47676063-47676085 GCTCAGGCACAGAGGGAGGCGGG + Intergenic
1190282447 X:48939988-48940010 ACACAGCTGCAGAGGGAGACAGG + Intronic
1191908869 X:66126586-66126608 GCTTAGTCCCAGAGGGACACTGG + Intergenic
1192138992 X:68631515-68631537 GCTCAGAGCCAGAGGGAGATGGG + Intergenic
1192350311 X:70350457-70350479 CCTCGGCAACAGAGGGAGACGGG + Intronic
1193679824 X:84504542-84504564 GCTTAGCTACAGAGTGAGAGGGG - Intergenic
1195171452 X:102272577-102272599 GGTCCGGGCCAGAGGGAGACAGG - Intergenic
1195187408 X:102414522-102414544 GGTCCGGGCCAGAGGGAGACAGG + Intronic
1198600951 X:138283417-138283439 GCTTGGCATCAGAGGGAGACCGG + Intergenic