ID: 968647983

View in Genome Browser
Species Human (GRCh38)
Location 4:1749410-1749432
Sequence GTGGGGAAGGGGGAGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23487
Summary {0: 2, 1: 15, 2: 628, 3: 9934, 4: 12908}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968647983 Original CRISPR GTGGGGAAGGGGGAGGTGGG GGG (reversed) Intergenic
Too many off-targets to display for this crispr