ID: 968649270

View in Genome Browser
Species Human (GRCh38)
Location 4:1753982-1754004
Sequence TCCCCATGGTGTCGGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968649270_968649279 13 Left 968649270 4:1753982-1754004 CCCCCAGCCCGACACCATGGGGA No data
Right 968649279 4:1754018-1754040 GCCACCAGCTTGCTCCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968649270 Original CRISPR TCCCCATGGTGTCGGGCTGG GGG (reversed) Intergenic
No off target data available for this crispr