ID: 968650841

View in Genome Browser
Species Human (GRCh38)
Location 4:1759701-1759723
Sequence CACCCTTCGGGGCCGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968650824_968650841 26 Left 968650824 4:1759652-1759674 CCATCCTGAAACCCCATCTCCGC No data
Right 968650841 4:1759701-1759723 CACCCTTCGGGGCCGGGCCTGGG No data
968650831_968650841 0 Left 968650831 4:1759678-1759700 CCGACAGCTGTAATCCCACCAGT No data
Right 968650841 4:1759701-1759723 CACCCTTCGGGGCCGGGCCTGGG No data
968650830_968650841 1 Left 968650830 4:1759677-1759699 CCCGACAGCTGTAATCCCACCAG No data
Right 968650841 4:1759701-1759723 CACCCTTCGGGGCCGGGCCTGGG No data
968650823_968650841 27 Left 968650823 4:1759651-1759673 CCCATCCTGAAACCCCATCTCCG No data
Right 968650841 4:1759701-1759723 CACCCTTCGGGGCCGGGCCTGGG No data
968650827_968650841 14 Left 968650827 4:1759664-1759686 CCCATCTCCGCAGCCCGACAGCT No data
Right 968650841 4:1759701-1759723 CACCCTTCGGGGCCGGGCCTGGG No data
968650826_968650841 15 Left 968650826 4:1759663-1759685 CCCCATCTCCGCAGCCCGACAGC No data
Right 968650841 4:1759701-1759723 CACCCTTCGGGGCCGGGCCTGGG No data
968650822_968650841 28 Left 968650822 4:1759650-1759672 CCCCATCCTGAAACCCCATCTCC No data
Right 968650841 4:1759701-1759723 CACCCTTCGGGGCCGGGCCTGGG No data
968650828_968650841 13 Left 968650828 4:1759665-1759687 CCATCTCCGCAGCCCGACAGCTG No data
Right 968650841 4:1759701-1759723 CACCCTTCGGGGCCGGGCCTGGG No data
968650825_968650841 22 Left 968650825 4:1759656-1759678 CCTGAAACCCCATCTCCGCAGCC No data
Right 968650841 4:1759701-1759723 CACCCTTCGGGGCCGGGCCTGGG No data
968650829_968650841 7 Left 968650829 4:1759671-1759693 CCGCAGCCCGACAGCTGTAATCC No data
Right 968650841 4:1759701-1759723 CACCCTTCGGGGCCGGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968650841 Original CRISPR CACCCTTCGGGGCCGGGCCT GGG Intergenic
No off target data available for this crispr