ID: 968651684

View in Genome Browser
Species Human (GRCh38)
Location 4:1762658-1762680
Sequence TGCCAGGTTTAGACCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968651684_968651693 30 Left 968651684 4:1762658-1762680 CCTGCAGGGGTCTAAACCTGGCA No data
Right 968651693 4:1762711-1762733 GTGAGTGAGATGCGTGTGTCTGG No data
968651684_968651689 -8 Left 968651684 4:1762658-1762680 CCTGCAGGGGTCTAAACCTGGCA No data
Right 968651689 4:1762673-1762695 ACCTGGCAGAAGGGGAGCCAGGG No data
968651684_968651688 -9 Left 968651684 4:1762658-1762680 CCTGCAGGGGTCTAAACCTGGCA No data
Right 968651688 4:1762672-1762694 AACCTGGCAGAAGGGGAGCCAGG No data
968651684_968651691 -5 Left 968651684 4:1762658-1762680 CCTGCAGGGGTCTAAACCTGGCA No data
Right 968651691 4:1762676-1762698 TGGCAGAAGGGGAGCCAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968651684 Original CRISPR TGCCAGGTTTAGACCCCTGC AGG (reversed) Intergenic
No off target data available for this crispr