ID: 968652015

View in Genome Browser
Species Human (GRCh38)
Location 4:1763886-1763908
Sequence GAGGCTGCCCAGAGGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968652015_968652031 29 Left 968652015 4:1763886-1763908 CCCAGAGCCCTCTGGGCAGCCTC No data
Right 968652031 4:1763938-1763960 CTGGCCTGTGCTCATCCAGGAGG No data
968652015_968652026 10 Left 968652015 4:1763886-1763908 CCCAGAGCCCTCTGGGCAGCCTC No data
Right 968652026 4:1763919-1763941 CCAGACCCCACAGTACGAGCTGG No data
968652015_968652030 26 Left 968652015 4:1763886-1763908 CCCAGAGCCCTCTGGGCAGCCTC No data
Right 968652030 4:1763935-1763957 GAGCTGGCCTGTGCTCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968652015 Original CRISPR GAGGCTGCCCAGAGGGCTCT GGG (reversed) Intergenic
No off target data available for this crispr