ID: 968653036

View in Genome Browser
Species Human (GRCh38)
Location 4:1767486-1767508
Sequence CCCGGTGGGGACACCGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968653036_968653051 13 Left 968653036 4:1767486-1767508 CCGGCCTCGGTGTCCCCACCGGG No data
Right 968653051 4:1767522-1767544 CCCTCCGGGCGCCGAGGGCTGGG No data
968653036_968653046 -1 Left 968653036 4:1767486-1767508 CCGGCCTCGGTGTCCCCACCGGG No data
Right 968653046 4:1767508-1767530 GAGGCGCGCGCGGACCCTCCGGG No data
968653036_968653045 -2 Left 968653036 4:1767486-1767508 CCGGCCTCGGTGTCCCCACCGGG No data
Right 968653045 4:1767507-1767529 GGAGGCGCGCGCGGACCCTCCGG No data
968653036_968653056 21 Left 968653036 4:1767486-1767508 CCGGCCTCGGTGTCCCCACCGGG No data
Right 968653056 4:1767530-1767552 GCGCCGAGGGCTGGGGTCCCGGG No data
968653036_968653049 12 Left 968653036 4:1767486-1767508 CCGGCCTCGGTGTCCCCACCGGG No data
Right 968653049 4:1767521-1767543 ACCCTCCGGGCGCCGAGGGCTGG No data
968653036_968653055 20 Left 968653036 4:1767486-1767508 CCGGCCTCGGTGTCCCCACCGGG No data
Right 968653055 4:1767529-1767551 GGCGCCGAGGGCTGGGGTCCCGG No data
968653036_968653053 14 Left 968653036 4:1767486-1767508 CCGGCCTCGGTGTCCCCACCGGG No data
Right 968653053 4:1767523-1767545 CCTCCGGGCGCCGAGGGCTGGGG No data
968653036_968653048 8 Left 968653036 4:1767486-1767508 CCGGCCTCGGTGTCCCCACCGGG No data
Right 968653048 4:1767517-1767539 GCGGACCCTCCGGGCGCCGAGGG No data
968653036_968653058 28 Left 968653036 4:1767486-1767508 CCGGCCTCGGTGTCCCCACCGGG No data
Right 968653058 4:1767537-1767559 GGGCTGGGGTCCCGGGCGCGAGG No data
968653036_968653047 7 Left 968653036 4:1767486-1767508 CCGGCCTCGGTGTCCCCACCGGG No data
Right 968653047 4:1767516-1767538 CGCGGACCCTCCGGGCGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968653036 Original CRISPR CCCGGTGGGGACACCGAGGC CGG (reversed) Intergenic
No off target data available for this crispr