ID: 968655205

View in Genome Browser
Species Human (GRCh38)
Location 4:1775575-1775597
Sequence CAGCCCCACCTGCAGATCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968655191_968655205 24 Left 968655191 4:1775528-1775550 CCTCTGAGCTCTGCCCATTCCCA No data
Right 968655205 4:1775575-1775597 CAGCCCCACCTGCAGATCTGGGG No data
968655199_968655205 -2 Left 968655199 4:1775554-1775576 CCGCCAGCACTCCCTGTGGGGCA No data
Right 968655205 4:1775575-1775597 CAGCCCCACCTGCAGATCTGGGG No data
968655192_968655205 11 Left 968655192 4:1775541-1775563 CCCATTCCCATAGCCGCCAGCAC No data
Right 968655205 4:1775575-1775597 CAGCCCCACCTGCAGATCTGGGG No data
968655193_968655205 10 Left 968655193 4:1775542-1775564 CCATTCCCATAGCCGCCAGCACT No data
Right 968655205 4:1775575-1775597 CAGCCCCACCTGCAGATCTGGGG No data
968655200_968655205 -5 Left 968655200 4:1775557-1775579 CCAGCACTCCCTGTGGGGCAGCC No data
Right 968655205 4:1775575-1775597 CAGCCCCACCTGCAGATCTGGGG No data
968655194_968655205 5 Left 968655194 4:1775547-1775569 CCCATAGCCGCCAGCACTCCCTG No data
Right 968655205 4:1775575-1775597 CAGCCCCACCTGCAGATCTGGGG No data
968655195_968655205 4 Left 968655195 4:1775548-1775570 CCATAGCCGCCAGCACTCCCTGT No data
Right 968655205 4:1775575-1775597 CAGCCCCACCTGCAGATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968655205 Original CRISPR CAGCCCCACCTGCAGATCTG GGG Intergenic
No off target data available for this crispr