ID: 968655247

View in Genome Browser
Species Human (GRCh38)
Location 4:1775762-1775784
Sequence GGCCAATGGGCTTTGTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968655247_968655258 28 Left 968655247 4:1775762-1775784 CCAGCCCACAAAGCCCATTGGCC No data
Right 968655258 4:1775813-1775835 CACAGGCCCCATGCTCCAGCTGG No data
968655247_968655259 29 Left 968655247 4:1775762-1775784 CCAGCCCACAAAGCCCATTGGCC No data
Right 968655259 4:1775814-1775836 ACAGGCCCCATGCTCCAGCTGGG No data
968655247_968655254 -4 Left 968655247 4:1775762-1775784 CCAGCCCACAAAGCCCATTGGCC No data
Right 968655254 4:1775781-1775803 GGCCGTGGATGAGCGGACATTGG No data
968655247_968655256 11 Left 968655247 4:1775762-1775784 CCAGCCCACAAAGCCCATTGGCC No data
Right 968655256 4:1775796-1775818 GACATTGGACAAACAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968655247 Original CRISPR GGCCAATGGGCTTTGTGGGC TGG (reversed) Intergenic
No off target data available for this crispr