ID: 968655894

View in Genome Browser
Species Human (GRCh38)
Location 4:1778323-1778345
Sequence CCCCGGAGATGGCCGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968655885_968655894 -5 Left 968655885 4:1778305-1778327 CCCGCCACATTCCTGCCTCCCCG No data
Right 968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG No data
968655874_968655894 18 Left 968655874 4:1778282-1778304 CCCCACCCCCAGCCAGAGCCCCG No data
Right 968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG No data
968655875_968655894 17 Left 968655875 4:1778283-1778305 CCCACCCCCAGCCAGAGCCCCGC No data
Right 968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG No data
968655881_968655894 6 Left 968655881 4:1778294-1778316 CCAGAGCCCCGCCCGCCACATTC No data
Right 968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG No data
968655886_968655894 -6 Left 968655886 4:1778306-1778328 CCGCCACATTCCTGCCTCCCCGG No data
Right 968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG No data
968655879_968655894 11 Left 968655879 4:1778289-1778311 CCCAGCCAGAGCCCCGCCCGCCA No data
Right 968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG No data
968655876_968655894 16 Left 968655876 4:1778284-1778306 CCACCCCCAGCCAGAGCCCCGCC No data
Right 968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG No data
968655877_968655894 13 Left 968655877 4:1778287-1778309 CCCCCAGCCAGAGCCCCGCCCGC No data
Right 968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG No data
968655883_968655894 -1 Left 968655883 4:1778301-1778323 CCCGCCCGCCACATTCCTGCCTC No data
Right 968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG No data
968655880_968655894 10 Left 968655880 4:1778290-1778312 CCAGCCAGAGCCCCGCCCGCCAC No data
Right 968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG No data
968655884_968655894 -2 Left 968655884 4:1778302-1778324 CCGCCCGCCACATTCCTGCCTCC No data
Right 968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG No data
968655888_968655894 -9 Left 968655888 4:1778309-1778331 CCACATTCCTGCCTCCCCGGAGA No data
Right 968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG No data
968655882_968655894 0 Left 968655882 4:1778300-1778322 CCCCGCCCGCCACATTCCTGCCT No data
Right 968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG No data
968655878_968655894 12 Left 968655878 4:1778288-1778310 CCCCAGCCAGAGCCCCGCCCGCC No data
Right 968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG No data
968655873_968655894 19 Left 968655873 4:1778281-1778303 CCCCCACCCCCAGCCAGAGCCCC No data
Right 968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968655894 Original CRISPR CCCCGGAGATGGCCGTGGCC AGG Intergenic
No off target data available for this crispr