ID: 968659308

View in Genome Browser
Species Human (GRCh38)
Location 4:1792672-1792694
Sequence CCCAGGCCTGTGTCCTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968659299_968659308 11 Left 968659299 4:1792638-1792660 CCGCTCTTCATCCTAGGCCGGGC No data
Right 968659308 4:1792672-1792694 CCCAGGCCTGTGTCCTCCTTGGG No data
968659301_968659308 0 Left 968659301 4:1792649-1792671 CCTAGGCCGGGCAGGCAGCCAGC 0: 1
1: 0
2: 3
3: 52
4: 434
Right 968659308 4:1792672-1792694 CCCAGGCCTGTGTCCTCCTTGGG No data
968659294_968659308 14 Left 968659294 4:1792635-1792657 CCCCCGCTCTTCATCCTAGGCCG No data
Right 968659308 4:1792672-1792694 CCCAGGCCTGTGTCCTCCTTGGG No data
968659295_968659308 13 Left 968659295 4:1792636-1792658 CCCCGCTCTTCATCCTAGGCCGG No data
Right 968659308 4:1792672-1792694 CCCAGGCCTGTGTCCTCCTTGGG No data
968659291_968659308 28 Left 968659291 4:1792621-1792643 CCAGGGGTATCCAGCCCCCGCTC No data
Right 968659308 4:1792672-1792694 CCCAGGCCTGTGTCCTCCTTGGG No data
968659292_968659308 18 Left 968659292 4:1792631-1792653 CCAGCCCCCGCTCTTCATCCTAG No data
Right 968659308 4:1792672-1792694 CCCAGGCCTGTGTCCTCCTTGGG No data
968659302_968659308 -6 Left 968659302 4:1792655-1792677 CCGGGCAGGCAGCCAGCCCCAGG No data
Right 968659308 4:1792672-1792694 CCCAGGCCTGTGTCCTCCTTGGG No data
968659297_968659308 12 Left 968659297 4:1792637-1792659 CCCGCTCTTCATCCTAGGCCGGG 0: 1
1: 0
2: 1
3: 18
4: 165
Right 968659308 4:1792672-1792694 CCCAGGCCTGTGTCCTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968659308 Original CRISPR CCCAGGCCTGTGTCCTCCTT GGG Intergenic
No off target data available for this crispr