ID: 968660717

View in Genome Browser
Species Human (GRCh38)
Location 4:1797716-1797738
Sequence CCTGTAGGGACCCCGCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 77}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968660717_968660730 13 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660730 4:1797752-1797774 CTGTGGGTCCCGGTGGGGCGAGG 0: 1
1: 0
2: 2
3: 23
4: 311
968660717_968660734 23 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660734 4:1797762-1797784 CGGTGGGGCGAGGGCTCCTTCGG 0: 1
1: 0
2: 0
3: 7
4: 125
968660717_968660729 8 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660729 4:1797747-1797769 TTGAGCTGTGGGTCCCGGTGGGG 0: 1
1: 0
2: 1
3: 21
4: 147
968660717_968660728 7 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660728 4:1797746-1797768 CTTGAGCTGTGGGTCCCGGTGGG No data
968660717_968660724 -3 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660724 4:1797736-1797758 AGGGGCAGTCCTTGAGCTGTGGG 0: 1
1: 0
2: 3
3: 19
4: 155
968660717_968660731 14 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660731 4:1797753-1797775 TGTGGGTCCCGGTGGGGCGAGGG 0: 1
1: 0
2: 1
3: 12
4: 163
968660717_968660723 -4 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660723 4:1797735-1797757 CAGGGGCAGTCCTTGAGCTGTGG 0: 1
1: 1
2: 5
3: 39
4: 586
968660717_968660727 6 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660727 4:1797745-1797767 CCTTGAGCTGTGGGTCCCGGTGG 0: 1
1: 0
2: 3
3: 13
4: 164
968660717_968660725 3 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660725 4:1797742-1797764 AGTCCTTGAGCTGTGGGTCCCGG 0: 1
1: 0
2: 0
3: 23
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968660717 Original CRISPR CCTGTAGGGACCCCGCAGTC AGG (reversed) Intronic
900286174 1:1901689-1901711 CCTCTAGGGGCCTCGCAGTCAGG - Intergenic
901051511 1:6427936-6427958 CGTGTAGGCAGCTCGCAGTCAGG + Intronic
901739735 1:11334420-11334442 CCTGTAGGGTCCACCCAGCCGGG - Intergenic
902239176 1:15076961-15076983 CCTGTGGGGACCCTGCAGATAGG + Intronic
902482808 1:16720429-16720451 CGTGTAGGCAGCTCGCAGTCAGG - Intergenic
902616235 1:17625015-17625037 CCTGTAGGGAGCCTGCTGGCTGG + Intronic
907406680 1:54258068-54258090 CATGATGGGACCCCACAGTCAGG - Exonic
910669803 1:89761794-89761816 CCTGTGGGGGCCCCACAGACAGG + Intronic
918051231 1:180974191-180974213 TCTGTAGGGACTGCCCAGTCAGG + Exonic
921228517 1:213045139-213045161 CCTGTAGGGTACTCGAAGTCCGG + Intergenic
1063450623 10:6147759-6147781 CCTGTATGGACCACCCCGTCAGG - Intronic
1063450632 10:6147785-6147807 CCTGTATGGACCACCCCGTCAGG - Intronic
1063450650 10:6147839-6147861 CCTGTATGGACCACCCCGTCAGG - Intronic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1066724055 10:38371425-38371447 CCTTTAGTGACCCCGTAGACTGG + Intergenic
1069949267 10:72008110-72008132 CATGTAGCGGCCCCGCAGCCAGG - Exonic
1073100481 10:101003876-101003898 CCAGTAGGGACCCCTCGGGCTGG - Exonic
1073930212 10:108566719-108566741 CCTGGAGGTGCCCCCCAGTCAGG + Intergenic
1074588938 10:114794029-114794051 CCTGTAGGCACCATGCAGTCTGG + Intergenic
1075544256 10:123342623-123342645 CCTGGAGAGTCCCCGAAGTCAGG + Intergenic
1076444111 10:130500246-130500268 CCTGCAGGGCTCCCGCAGACTGG - Intergenic
1076500322 10:130931402-130931424 CCTGTAGGAATCACCCAGTCTGG - Intergenic
1090720342 11:129466977-129466999 CCATGAGGGACCCCGCAGTGAGG + Intergenic
1093358958 12:18200853-18200875 CCTGTAGGCAGACAGCAGTCGGG - Intronic
1097065177 12:56315601-56315623 CCGGCAGGGAGCCCTCAGTCAGG + Intronic
1104023617 12:125010449-125010471 CCTGTAGGAACCATCCAGTCAGG + Intronic
1114447934 14:22803863-22803885 CCTGTAGGGAACGCACAGTGTGG - Intronic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1123025355 14:105421309-105421331 CCTCGAGGGACCCCGCACCCAGG - Intronic
1124226279 15:27897685-27897707 CCAGTAGGGACTCCTCAGTGTGG - Intronic
1127663772 15:61124328-61124350 CCTGGAGGTAGACCGCAGTCGGG - Intronic
1129769488 15:78194096-78194118 CCTGCAGGTCCCCTGCAGTCTGG - Intronic
1131187480 15:90287296-90287318 CCTGTGCGGACCCCGGTGTCGGG + Intronic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1135548227 16:23379749-23379771 CCTGTAGGGAACTGGTAGTCAGG + Intronic
1140123888 16:72104869-72104891 CTTGTAGAGGCCTCGCAGTCAGG + Intronic
1140196924 16:72862774-72862796 CTTGTAGGATCCCTGCAGTCGGG - Intronic
1142495710 17:305333-305355 CCTGTGGGGCCTCCGCAGTGTGG - Intronic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1146014215 17:29219515-29219537 CCTCAAGGGACCCCGCTTTCCGG + Intergenic
1147877588 17:43632485-43632507 CCTGGGGGGACCCCTCAGTCAGG - Intergenic
1154399890 18:14026224-14026246 CCAGGAGGGGACCCGCAGTCTGG - Intergenic
1157051857 18:44175573-44175595 CCTGTTGGGTCACCTCAGTCTGG - Intergenic
1160824632 19:1073959-1073981 CCTGTATGGACCGGGCAGTGAGG + Exonic
1161442221 19:4298411-4298433 CCCCTAGTGAGCCCGCAGTCTGG + Intronic
1161690109 19:5727464-5727486 CCTGTAGGGAGTCCATAGTCAGG + Intronic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166106447 19:40600312-40600334 CCTCTAGGGACCCCAGCGTCCGG + Intronic
1166361541 19:42254720-42254742 CCTACCGGGACCCCGCAGGCCGG - Intronic
927071361 2:19532861-19532883 CCTGTAGGAACCCAGCCATCAGG - Intergenic
927938303 2:27087422-27087444 GCTGCAGAGACCCCGCAGTGAGG + Intronic
946165778 2:217862995-217863017 CCTGGAGAGACCCCTCAGTGTGG - Intronic
948653628 2:239463993-239464015 GCTGTGGGGACCGCTCAGTCCGG - Intergenic
1176146101 20:63566231-63566253 CCTGCAGGGGGCACGCAGTCAGG + Exonic
1176725181 21:10425902-10425924 CCTGTAGAGTTCCCGTAGTCAGG + Intergenic
1182264691 22:29105033-29105055 CCTGTGGGGAATCCTCAGTCTGG + Intronic
1184254026 22:43276931-43276953 TCTGTAGGGAGCAGGCAGTCAGG - Intronic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
950021959 3:9793382-9793404 CCTGTAGGAACCCGGAAGTGGGG + Intronic
954596452 3:51829598-51829620 CCTGTGGGGACTTTGCAGTCAGG + Intronic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
968555169 4:1243296-1243318 CCTGAAAGGACCCTGCAGTGAGG + Intronic
968660717 4:1797716-1797738 CCTGTAGGGACCCCGCAGTCAGG - Intronic
968689949 4:1985283-1985305 CCTGAAGTGACCCCACAGTGTGG + Intronic
992706442 5:79399255-79399277 CCTGAAGGTACTCTGCAGTCTGG + Intronic
994452126 5:99955988-99956010 CCTGTAGGCACCCCTCAGCATGG - Intergenic
1005960682 6:30690850-30690872 CTTGGAGGGATCCCGGAGTCTGG - Exonic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1020013509 7:4818525-4818547 GCTGGAGGGACCCCGGGGTCCGG + Intronic
1020281384 7:6651992-6652014 CCTGGAGGGAGCCGGCGGTCTGG + Intronic
1040480055 8:47817237-47817259 CCTGTGGGGACGCTGCTGTCGGG - Intronic
1042155816 8:65842494-65842516 CCAGCAGTGACCCCGCGGTCAGG - Intergenic
1049377140 8:142294646-142294668 CCTGTATGGACCCTGCTGACCGG - Intronic
1049748864 8:144274241-144274263 CCTGAAGGGCCCCGGCAGTGAGG + Intronic
1059341014 9:113597585-113597607 CCTGGGGGGACACTGCAGTCTGG + Exonic
1061993678 9:134173547-134173569 CCTGGAGGGACCCCCGAGGCTGG - Intergenic
1190309004 X:49103231-49103253 CCAGGAAGCACCCCGCAGTCGGG + Intergenic
1191782059 X:64879411-64879433 CTTGGAGGCACCCCTCAGTCAGG + Intergenic
1202091021 Y:21190227-21190249 TCAGTAGAGACCCTGCAGTCAGG - Intergenic