ID: 968660717

View in Genome Browser
Species Human (GRCh38)
Location 4:1797716-1797738
Sequence CCTGTAGGGACCCCGCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 77}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968660717_968660725 3 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660725 4:1797742-1797764 AGTCCTTGAGCTGTGGGTCCCGG 0: 1
1: 0
2: 0
3: 23
4: 236
968660717_968660728 7 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660728 4:1797746-1797768 CTTGAGCTGTGGGTCCCGGTGGG No data
968660717_968660730 13 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660730 4:1797752-1797774 CTGTGGGTCCCGGTGGGGCGAGG 0: 1
1: 0
2: 2
3: 23
4: 311
968660717_968660724 -3 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660724 4:1797736-1797758 AGGGGCAGTCCTTGAGCTGTGGG 0: 1
1: 0
2: 3
3: 19
4: 155
968660717_968660727 6 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660727 4:1797745-1797767 CCTTGAGCTGTGGGTCCCGGTGG 0: 1
1: 0
2: 3
3: 13
4: 164
968660717_968660723 -4 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660723 4:1797735-1797757 CAGGGGCAGTCCTTGAGCTGTGG 0: 1
1: 1
2: 5
3: 39
4: 586
968660717_968660729 8 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660729 4:1797747-1797769 TTGAGCTGTGGGTCCCGGTGGGG 0: 1
1: 0
2: 1
3: 21
4: 147
968660717_968660731 14 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660731 4:1797753-1797775 TGTGGGTCCCGGTGGGGCGAGGG 0: 1
1: 0
2: 1
3: 12
4: 163
968660717_968660734 23 Left 968660717 4:1797716-1797738 CCTGACTGCGGGGTCCCTACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 968660734 4:1797762-1797784 CGGTGGGGCGAGGGCTCCTTCGG 0: 1
1: 0
2: 0
3: 7
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968660717 Original CRISPR CCTGTAGGGACCCCGCAGTC AGG (reversed) Intronic