ID: 968661074

View in Genome Browser
Species Human (GRCh38)
Location 4:1799045-1799067
Sequence CCGGAGTCCTTGGGACAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968661074 Original CRISPR CCGGAGTCCTTGGGACAGAC TGG Intronic
904173032 1:28605338-28605360 CCAGAGCCCTGGGGACAGCCAGG - Intronic
904279550 1:29409306-29409328 CTGGAGTCATTGGCACAGCCAGG + Intergenic
905802278 1:40852294-40852316 CCAGAGTACTTGGTACAGATGGG - Intergenic
905856413 1:41317500-41317522 CCGCATTCCATGGGACAGGCTGG + Intergenic
906999397 1:50834441-50834463 TCAGAGTCATTGGGAAAGACAGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
912631861 1:111253246-111253268 CCAGAGGCCTTGGAACAGCCAGG - Intergenic
915318272 1:155041900-155041922 GCTGAGTCCTTGGGACCCACTGG + Intronic
915980160 1:160415436-160415458 CCTGAGTCCTTGGCACAGCCTGG + Intronic
923446052 1:234072536-234072558 CAGGAGGGCCTGGGACAGACAGG + Intronic
924444211 1:244113660-244113682 CCGCATTCTTTGGGAGAGACAGG + Intergenic
1068136766 10:52956544-52956566 CCTGATTCCTTGGGCCACACTGG + Intergenic
1068418503 10:56758795-56758817 TCGGAGTCCTTTGAAGAGACGGG + Intergenic
1070800448 10:79242199-79242221 CCGGAGCCCTTGCGACAGACTGG + Intronic
1072821612 10:98563856-98563878 CAGGGGTCCTGGGGTCAGACAGG + Intronic
1073323953 10:102631841-102631863 CTGGAGTATTTGGGAGAGACTGG + Exonic
1073435061 10:103511244-103511266 CCTGTGTCCCTGGGACAGACTGG - Intronic
1073942758 10:108716696-108716718 CCAGAATCCTTGGGACACTCTGG - Intergenic
1075111310 10:119587265-119587287 CAGGAGTGCTTGAGACAGAGAGG - Intronic
1075586968 10:123665483-123665505 CAGCTGTTCTTGGGACAGACAGG + Intergenic
1077677026 11:4204298-4204320 GCAGAGGCCATGGGACAGACAGG - Intergenic
1081397765 11:42607046-42607068 CCACTGTCCATGGGACAGACAGG - Intergenic
1082808309 11:57463674-57463696 CCGTGGTCCTCGGGAGAGACAGG + Intronic
1083511233 11:63210996-63211018 CCTCAGCCCTTGGGACAGTCAGG - Intronic
1084265691 11:68004077-68004099 CCGGAGTCCCTGCGACCGCCCGG + Exonic
1092759855 12:11799887-11799909 TCTGGGTCCCTGGGACAGACAGG + Intronic
1094595541 12:31862852-31862874 CCGGAGTCCTTGGGATATACAGG - Intergenic
1095992942 12:48050514-48050536 CCTGAGTCCTTTGGGCTGACTGG - Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1103060489 12:117854665-117854687 GCGGATCCCTTGGGACAGAAAGG + Intronic
1103705050 12:122867016-122867038 CCAGAGCCCTTGGCACAGAGCGG + Exonic
1104919740 12:132284654-132284676 CCCGAGTCCTTTAGACAAACAGG - Intronic
1109865045 13:68252516-68252538 CCTGAGTCCTGGGGATATACAGG - Intergenic
1113446070 13:110368179-110368201 CTGGAGTCCTTAGAACAGAGTGG - Intronic
1114069045 14:19094006-19094028 TAGGAGGACTTGGGACAGACAGG - Intergenic
1114093215 14:19305999-19306021 TAGGAGGACTTGGGACAGACAGG + Intergenic
1122891380 14:104733732-104733754 CTGGGGTCCTGGGGACAGAGTGG + Intronic
1126324746 15:47464477-47464499 CAGGAGTCCTTGGCATGGACTGG - Intronic
1128741337 15:70085870-70085892 CAGAAGTCCTGGGGAAAGACAGG - Intronic
1129333643 15:74840060-74840082 CCTGAGGCCCTGGGACAGCCTGG + Intronic
1129379250 15:75154997-75155019 CCGGAGTCCTTGGGCTGGCCTGG + Intergenic
1130957715 15:88639152-88639174 CCAGAGGCCCTGGGACACACGGG + Intronic
1133229802 16:4361107-4361129 CAGGAGCCCTTGGGAGACACTGG + Intronic
1133537552 16:6716598-6716620 CCTGAGTCCTTCTTACAGACAGG + Intronic
1135966578 16:27040591-27040613 CAGGTGTCCTGGGGTCAGACAGG - Intergenic
1136782397 16:32915256-32915278 CGGGAGGCCTTGGTACAGCCTGG + Intergenic
1136887396 16:33938595-33938617 CCGGAGGCCTTGGTACAGCCTGG - Intergenic
1137401078 16:48155034-48155056 CCTGGGACCTGGGGACAGACAGG - Intronic
1138023010 16:53502018-53502040 CCGGATCCCTTGGGACACAGTGG + Intronic
1139380626 16:66528312-66528334 CCTGAGCCCTTGGCACTGACAGG + Intronic
1142250891 16:88991355-88991377 CCGGACTCCTCGGAACAGCCAGG - Intergenic
1203085057 16_KI270728v1_random:1179243-1179265 CGGGAGGCCTTGGTACAGCCTGG + Intergenic
1144772815 17:17769355-17769377 CAGGCCTCCTTGGGACAGCCCGG + Intronic
1144854086 17:18258510-18258532 CCGCAGTCCCTGGGACACGCAGG + Intronic
1147178346 17:38670476-38670498 CAAGTGTCCTTGTGACAGACAGG + Intergenic
1151367402 17:73626409-73626431 CCAGAGCCCCTGGGACAGGCTGG - Intronic
1152546092 17:81000735-81000757 TGGCAGTCCTGGGGACAGACAGG - Intronic
1156311077 18:35922696-35922718 TCAGAGTCCTGGGGACAGTCAGG - Intergenic
1162796597 19:13090473-13090495 CTGGAGTCCTTGGGGCTAACAGG + Intronic
927210278 2:20634946-20634968 ACAGCGTCCTTGGGACAGGCTGG - Intronic
928220501 2:29399327-29399349 GGTGAGTCCTTGGGACAGCCAGG + Intronic
935150137 2:100426682-100426704 CCGGAGTCCGTGAGACTGAAAGG + Intergenic
940168262 2:150799156-150799178 CTGGAATCCTTGGGACTGTCAGG - Intergenic
940258183 2:151754418-151754440 CCCAAATCCTTGGGACAGAAAGG + Intergenic
941427755 2:165369598-165369620 CCAGAGCCCTTGGGAAAGAGTGG - Intronic
942189512 2:173456353-173456375 CCGTAGCCCTTGGGGAAGACTGG + Intergenic
942418869 2:175787139-175787161 CCGGAGTCCTGAGCACAGAATGG + Intergenic
948485541 2:238278707-238278729 CAGGAGACATGGGGACAGACAGG + Intronic
948829865 2:240593406-240593428 CCAGAGACCTTGAGACAGATGGG - Intronic
1172443128 20:34979524-34979546 CAGGAGGCCTAGGGACAGAGAGG - Intronic
1173342331 20:42163553-42163575 CCATAGTCCTTGGCACAGAGTGG - Intronic
1175733437 20:61369907-61369929 CCAGAGTCCTGGGGACACAAAGG + Intronic
1175787709 20:61722594-61722616 GCAGAGTCCTTGGGACAGAGTGG - Intronic
1180487518 22:15816566-15816588 TAGGAGGACTTGGGACAGACAGG - Intergenic
1181940202 22:26470010-26470032 CAGGGGCCCTTGGGCCAGACAGG - Intronic
1184294956 22:43517289-43517311 GCTGGGTCCTGGGGACAGACAGG + Intergenic
1185208556 22:49553985-49554007 CCGGTGTCCATGGGCCACACTGG - Intronic
1185208570 22:49554053-49554075 CCGGCGTCCATGGGCCACACTGG - Intronic
1185245548 22:49771080-49771102 CCGGTGGCCTTGGGCCAGAACGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950336491 3:12198175-12198197 CCAGCGTCTTTGGGACAGAGAGG - Intergenic
950442895 3:13020104-13020126 CTGGAAACCTTGGGACAGAAGGG + Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
952094935 3:29939594-29939616 TGGGAGTTCTTGGGACAAACTGG - Intronic
954377883 3:50204587-50204609 TTGGTGTCCTGGGGACAGACAGG - Intergenic
959690103 3:109189377-109189399 CTGGAGAACTTGGGACAGAGAGG - Intergenic
961622183 3:128232891-128232913 CCGGACTCCTTGGCCCTGACAGG + Intronic
962755002 3:138460032-138460054 CCGCAGTCCTTGGGACTCACCGG - Exonic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
968505472 4:969180-969202 CCCGGGTCCTGGGGACAGCCTGG + Intronic
968661074 4:1799045-1799067 CCGGAGTCCTTGGGACAGACTGG + Intronic
969305584 4:6324591-6324613 CCCGAGTCCTCGGGACAGGCGGG - Intronic
969632692 4:8347571-8347593 TCTGAGTACTTGGGACAGGCAGG - Intergenic
970218680 4:13785319-13785341 CCTGAGTTCTGGGGTCAGACAGG - Intergenic
973377636 4:49298134-49298156 CGGGAGTAGCTGGGACAGACAGG + Intergenic
973378556 4:49304270-49304292 CGGGAGTAGCTGGGACAGACAGG + Intergenic
975924428 4:79432040-79432062 CCAGAGTCCCTGGGACAGAAAGG - Intergenic
981569518 4:146136864-146136886 CCCGAGTCCTCGGGAGAGACAGG - Intergenic
982362207 4:154531182-154531204 CCAAAGGCCTTGGGAGAGACAGG + Intergenic
985782053 5:1876604-1876626 CCGTAGTCCTTGGGACACCTGGG + Intergenic
988364548 5:30279450-30279472 CCAGAGTGCTTGGGACTCACAGG - Intergenic
993879537 5:93346561-93346583 CCAGAGTCCTTGCTAGAGACTGG - Intergenic
997297716 5:132777952-132777974 CCCAAGCCCTTGGGACAGGCAGG - Intronic
997585716 5:135041833-135041855 CCTGAGTCCTGTGGACAGAGGGG + Intronic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
1000168345 5:158677308-158677330 CAGGAGTCCTTGGGGCAGGAGGG - Intergenic
1005927274 6:30453847-30453869 CCTCAGTCCTTGGGCCACACGGG + Intergenic
1006077973 6:31546533-31546555 CTGGATACCTTGGGACTGACTGG + Exonic
1007721597 6:43888446-43888468 CCAGTGTCCTTGGCACAGGCAGG + Intergenic
1007902122 6:45422308-45422330 CCGGAGTCTTTGGAACACCCGGG - Intronic
1009622410 6:66094675-66094697 GCGGAGCCCTGGGGAGAGACTGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017157668 6:151336943-151336965 CAGAAGTTCTGGGGACAGACTGG - Intronic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018284712 6:162224941-162224963 CTGGTGTTCTTGGGAGAGACAGG + Intronic
1023204390 7:37732430-37732452 CTGTAGTCCATGGGACAGAATGG + Intronic
1023605045 7:41922566-41922588 CCAGAGCCCTTAGGACAGATTGG + Intergenic
1025233600 7:57219038-57219060 CTGGAGACCTTGGGAGAGGCTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1028709529 7:93891108-93891130 GCGGAGTTCTTGGGTCAGAGCGG + Intronic
1029448645 7:100628299-100628321 CCGGAAGCCTGGGGACAGAGGGG + Exonic
1029946900 7:104542460-104542482 CCCGAGACCTTGTCACAGACTGG + Intronic
1035671732 8:1423290-1423312 GCTCAGTCCATGGGACAGACAGG + Intergenic
1036708485 8:11062047-11062069 CTGCATTCCATGGGACAGACAGG + Intronic
1038406587 8:27326696-27326718 CCAGAGTGGTTGGGAAAGACAGG - Intronic
1042532621 8:69831907-69831929 CCCGAGTCCTTCGGACAGGCCGG + Exonic
1049470482 8:142773134-142773156 CCTAAGTCCTTGGGAGAGGCTGG - Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1062409534 9:136415979-136416001 CAGCAGCACTTGGGACAGACAGG + Intronic
1185778975 X:2829350-2829372 CCGGAGTACGGAGGACAGACGGG + Intronic
1187398120 X:18935571-18935593 CATGATTCCTTGGGATAGACAGG + Intronic