ID: 968661243

View in Genome Browser
Species Human (GRCh38)
Location 4:1799676-1799698
Sequence CATCTGGGAGGGGCACCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 355}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968661229_968661243 -3 Left 968661229 4:1799656-1799678 CCAAATGGGGGACCCTGCCCCAT 0: 1
1: 0
2: 3
3: 8
4: 121
Right 968661243 4:1799676-1799698 CATCTGGGAGGGGCACCTGGGGG 0: 1
1: 0
2: 6
3: 41
4: 355
968661228_968661243 -2 Left 968661228 4:1799655-1799677 CCCAAATGGGGGACCCTGCCCCA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 968661243 4:1799676-1799698 CATCTGGGAGGGGCACCTGGGGG 0: 1
1: 0
2: 6
3: 41
4: 355
968661221_968661243 13 Left 968661221 4:1799640-1799662 CCCCAGGAAGTGCTGCCCAAATG 0: 1
1: 0
2: 3
3: 22
4: 309
Right 968661243 4:1799676-1799698 CATCTGGGAGGGGCACCTGGGGG 0: 1
1: 0
2: 6
3: 41
4: 355
968661224_968661243 11 Left 968661224 4:1799642-1799664 CCAGGAAGTGCTGCCCAAATGGG 0: 1
1: 0
2: 1
3: 11
4: 143
Right 968661243 4:1799676-1799698 CATCTGGGAGGGGCACCTGGGGG 0: 1
1: 0
2: 6
3: 41
4: 355
968661220_968661243 14 Left 968661220 4:1799639-1799661 CCCCCAGGAAGTGCTGCCCAAAT 0: 1
1: 0
2: 0
3: 15
4: 198
Right 968661243 4:1799676-1799698 CATCTGGGAGGGGCACCTGGGGG 0: 1
1: 0
2: 6
3: 41
4: 355
968661222_968661243 12 Left 968661222 4:1799641-1799663 CCCAGGAAGTGCTGCCCAAATGG 0: 1
1: 0
2: 0
3: 8
4: 169
Right 968661243 4:1799676-1799698 CATCTGGGAGGGGCACCTGGGGG 0: 1
1: 0
2: 6
3: 41
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968661243 Original CRISPR CATCTGGGAGGGGCACCTGG GGG Intronic
900193247 1:1360267-1360289 CCTCTGAGAGGGCCACCTGGGGG + Intronic
900492845 1:2961258-2961280 CATCTGGGAGACCCAGCTGGTGG - Intergenic
900539659 1:3196519-3196541 CTTCAGGCAGGGGCACCGGGCGG - Intronic
900762520 1:4482649-4482671 CAGCAGGGAGGAGCACGTGGTGG - Intergenic
900959422 1:5909727-5909749 ACACTGGGAGGCGCACCTGGGGG + Intronic
901457404 1:9371190-9371212 CATCTGGGAAAGGCATCTAGGGG - Intergenic
901654252 1:10760303-10760325 GATCTGGGAGTGGCATCTGATGG + Intronic
901782811 1:11605242-11605264 CATCTGGGCTGGGCAACTGCTGG + Intergenic
902546761 1:17195118-17195140 CATCTGGGAGGGCTTTCTGGAGG + Intergenic
902581879 1:17412988-17413010 CATCAGGGAGGGGCACCCCATGG + Intronic
903262180 1:22137233-22137255 CATGGGGGAGGGGGAGCTGGTGG + Intronic
903588843 1:24438746-24438768 CACCAGGGAGGGGAACCAGGCGG + Intronic
906110016 1:43316481-43316503 CATCTGGGTGGGGCTGATGGTGG - Intronic
906669236 1:47642817-47642839 GTTCAGGGTGGGGCACCTGGTGG + Intergenic
906697065 1:47830150-47830172 CATCTGGGAGGGGGACATCCTGG - Intronic
907559785 1:55377936-55377958 CAGCTGGGAGGGGCAAATGGGGG + Intergenic
909900117 1:81123725-81123747 CATGTGTCAGGGGCGCCTGGTGG + Intergenic
911359697 1:96862006-96862028 CATCTGAGAAAGCCACCTGGAGG - Intergenic
911669581 1:100592649-100592671 CATCTGGAAGGGGCCCCTCTGGG + Intergenic
911941954 1:104057823-104057845 CATCTGGCAGGGGCCCCTCTGGG + Intergenic
912775169 1:112502251-112502273 CAGCAGGGACGGGCAGCTGGAGG - Intronic
913061328 1:115211114-115211136 CATCTGTGTGGGGGCCCTGGTGG + Intergenic
914197163 1:145453564-145453586 GGTCTGGGAGGGGCACTTGGCGG - Intergenic
914681160 1:149939179-149939201 CTGCTGGGAGGGGCAGCCGGAGG + Exonic
915352643 1:155235917-155235939 CATGTGGGAGAGGCAGCTGTGGG + Intronic
917200954 1:172514822-172514844 CATCTGGGTGGTGCACTTGATGG - Intergenic
917653387 1:177101554-177101576 CAACTGGAAGGGGCACAGGGAGG + Intronic
918313623 1:183304619-183304641 CATGAGGGCGGGGCAGCTGGAGG - Intronic
919741186 1:200982578-200982600 GCTCTGGGAGGGGCACCATGGGG - Intronic
920190895 1:204193136-204193158 CATCAGGGAGGGCTTCCTGGAGG + Intronic
920515903 1:206584488-206584510 CATCAAGGAGGTGAACCTGGCGG + Exonic
922660567 1:227426532-227426554 CATATGGGAGGTGGACCTGGTGG - Intergenic
922750180 1:228066505-228066527 CATCTGGGAGGGCTTCCAGGAGG + Intergenic
923401836 1:233623273-233623295 CATCTGGGAAGGGTACGGGGAGG + Intronic
923462689 1:234220824-234220846 CATCTGGGAGGGAGAGATGGGGG + Intronic
923479481 1:234369600-234369622 GATCAGGGAGGGGCACATGGTGG - Intergenic
923630414 1:235645936-235645958 CATTAGGCAGGGGCACCAGGAGG + Intronic
923664111 1:235983582-235983604 CATCTTTGCGAGGCACCTGGAGG + Intronic
924658721 1:245996807-245996829 CCTATGGGAGGGGAACGTGGGGG + Intronic
1062904193 10:1169044-1169066 CCTCTGGGAGGTGCTGCTGGCGG - Intergenic
1063387713 10:5626523-5626545 CATGTGGGAGGGACATCTGTTGG - Intergenic
1064323378 10:14327074-14327096 CAGCTGGGAGGGGTCCCAGGTGG - Intronic
1068364951 10:56035809-56035831 CATCTGGGATAAGCACCTTGTGG + Intergenic
1068888568 10:62124549-62124571 CATCTGGGAAGGCTACCTGCAGG - Intergenic
1069814231 10:71183541-71183563 CATCTGGGAGGGGCCCCTGAGGG - Intergenic
1070491596 10:76981688-76981710 CATCTGGGAAGGCCCCCTGGAGG - Intronic
1070558888 10:77550871-77550893 CATCTGGGAGGTGAAGCTTGAGG - Intronic
1072738749 10:97896891-97896913 CACAGGTGAGGGGCACCTGGGGG - Exonic
1073446741 10:103585405-103585427 CACCTGGGAGACTCACCTGGGGG + Intronic
1074256334 10:111806303-111806325 CACCTGGGAGAGAGACCTGGGGG - Intergenic
1074714264 10:116203547-116203569 CATCAGAGAGAGGCAGCTGGGGG + Intronic
1074847453 10:117410767-117410789 CTTCTGAGAAGGCCACCTGGAGG + Intergenic
1075266523 10:121003591-121003613 CAGCTGGGAGAGGCAGCAGGAGG - Intergenic
1076187830 10:128462684-128462706 CACCTGGCAGGGGCAGCTGCGGG - Intergenic
1076214102 10:128679123-128679145 CATCTGGGAGGGGATTGTGGAGG + Intergenic
1076727192 10:132419399-132419421 CCTGAGGGAGGAGCACCTGGCGG + Intergenic
1077101853 11:825985-826007 CTTCTGGGAGGAGCAGGTGGGGG - Intergenic
1077199756 11:1300273-1300295 CCTCTGAGAGCGGCACATGGGGG - Intronic
1077383895 11:2260061-2260083 CATCTGGGAAGGCTTCCTGGAGG + Intergenic
1079009064 11:16813477-16813499 GACCTGGGAGGTCCACCTGGAGG + Intronic
1079330396 11:19528174-19528196 AATCTGGGAGGGGACCATGGAGG + Intronic
1080118020 11:28642040-28642062 CATCTGGCAGGTGCTCCTGTGGG + Intergenic
1081569322 11:44279693-44279715 AATCTGGGAGGGCTTCCTGGAGG - Intronic
1083596698 11:63921018-63921040 CATCTGGGAGTGGCCCTTGGGGG + Intergenic
1083614728 11:64020701-64020723 CACCTGGGAGGGGATTCTGGAGG - Intronic
1083776298 11:64895784-64895806 CATCTGGCAGGGGCGTCTGGGGG - Intronic
1084239935 11:67812185-67812207 TATCTGGAAGGGGCATCTTGGGG + Intergenic
1084266495 11:68008028-68008050 CCTCTGGGTAGGGCACCAGGAGG - Intergenic
1084832503 11:71780649-71780671 TATCTGGAAGGGGCATCTTGGGG - Intergenic
1085130652 11:74035393-74035415 AATCTGGGAAGGCCTCCTGGAGG - Intronic
1086422002 11:86645811-86645833 CATCTGGGAGGTGCCCCTCTGGG + Intronic
1086505386 11:87498456-87498478 CATCTGGCAGGTGCACCTCAGGG + Intergenic
1088818585 11:113437972-113437994 CAACTGGGAGAGGCAGCTGGGGG - Intronic
1089328622 11:117674583-117674605 TATCTGGGTGGGGTACCTTGCGG - Intronic
1089384723 11:118060177-118060199 CACATGGGTGGGGGACCTGGAGG - Intergenic
1089457256 11:118632819-118632841 CATCTGGGAGTGGCCCCTGCAGG - Intronic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1090658978 11:128867613-128867635 CATTTGTGAGGGGCTCCTTGGGG - Intergenic
1090928393 11:131273129-131273151 CATCTGGCAGGGGCCCCTCTGGG - Intergenic
1091689348 12:2585083-2585105 CATCTAGGATTGGCTCCTGGAGG - Intronic
1092165637 12:6340981-6341003 CAGCGGGGAGGGGAAGCTGGAGG + Intronic
1092262481 12:6959990-6960012 CAAGGGTGAGGGGCACCTGGGGG + Exonic
1096243828 12:49973580-49973602 GTGCAGGGAGGGGCACCTGGAGG + Intronic
1096244247 12:49975467-49975489 CTTCTGGGTGGGGCCCCTGATGG + Exonic
1096263219 12:50105541-50105563 CATCTGGGACAGCCACCTGTGGG - Exonic
1096630217 12:52921629-52921651 CATCTGGGAGGGCTTCCTGAAGG - Intronic
1099236017 12:80083652-80083674 CATCTGGCAGGTGCACCTCTGGG - Intergenic
1102698449 12:114818018-114818040 CAGCTGGCAGGGGCATCTGTGGG + Intergenic
1103336870 12:120196166-120196188 CAGCTGAGATAGGCACCTGGTGG - Intergenic
1103609932 12:122117105-122117127 CATGTGGGCGGAGCACCTGCAGG + Intronic
1104171994 12:126291267-126291289 CATTTGGGAGGGGCCAGTGGTGG - Intergenic
1106397021 13:29391062-29391084 AATCTGGGATGGGCACACGGTGG - Intronic
1107841678 13:44464762-44464784 AAGCTGGTAGGGGCTCCTGGTGG - Intronic
1108866206 13:54925503-54925525 AATTTGGGAGAGGAACCTGGTGG + Intergenic
1109145901 13:58779427-58779449 CAATTGGGAGGGGGACTTGGGGG + Intergenic
1109736552 13:66492661-66492683 CATCTCTGAGTGGCACCTGGTGG - Intronic
1110971726 13:81771321-81771343 CCTCTGGGTGGGGCAACTGCTGG - Intergenic
1111502639 13:89142244-89142266 CTTGTGGGAGGGGTACCTGGTGG - Intergenic
1112431236 13:99352058-99352080 CATCTGAGATGTGCACCAGGAGG + Intronic
1114617209 14:24074686-24074708 CACCTTGGAGAGGCACCAGGTGG - Exonic
1116634294 14:47375863-47375885 CTTTTGGGAGGGGCAGCTGTGGG - Intronic
1117791052 14:59342771-59342793 CATGTAGGAGGGGCACCAGCAGG + Intronic
1118599601 14:67462663-67462685 AAGCTGTGAGGGGCACCTCGTGG + Intronic
1118909025 14:70046053-70046075 CACCTGGGAGGGGAGCTTGGTGG - Exonic
1119551156 14:75514996-75515018 CCTCTGCGTGGGGCCCCTGGGGG + Intergenic
1119846546 14:77834765-77834787 CAGGTGGTAGGGGCAACTGGAGG - Intronic
1119955828 14:78797948-78797970 CATCTGTGGGAGGGACCTGGTGG - Intronic
1120449962 14:84654951-84654973 CATCTGGCAGGTGCACCTCTGGG - Intergenic
1120751006 14:88198363-88198385 CAGCTGGGAGGGGCATCTTTTGG - Intronic
1121309267 14:92926349-92926371 CACCTTGGAGGGGAACCTGCTGG + Intronic
1121441560 14:93953016-93953038 CATGGGGGAGGGGCACCCAGAGG - Intronic
1121710180 14:96031849-96031871 GATCAGGGAGGGCCTCCTGGAGG + Intergenic
1121777946 14:96603111-96603133 CATCTGAGAGGGGCACCGCCAGG + Intergenic
1122087985 14:99320346-99320368 CTTCTGGGAGGGGCACAGGGTGG + Intergenic
1122181222 14:99956163-99956185 CATCTTGGAGCGGCCTCTGGAGG + Intergenic
1122769613 14:104092153-104092175 CATCTGGGAGGGCTTCCTGGGGG + Intronic
1122919680 14:104874868-104874890 CAGCTGGGTGGGGCTCGTGGTGG - Intronic
1127933163 15:63611011-63611033 CATCTAGGAGGGGTTCTTGGAGG + Intronic
1128309722 15:66622442-66622464 CACCTGGGAGGGGCAGCCCGGGG - Intronic
1128735733 15:70053072-70053094 CATCTGGGAAGGCTTCCTGGAGG - Intronic
1129108336 15:73323546-73323568 CACCTGGGACGGGCTGCTGGCGG + Exonic
1129620307 15:77137818-77137840 GATCTGGGAGGGGCAAGGGGTGG + Intronic
1131116464 15:89799159-89799181 CATATGGGAAGGGCAGCAGGAGG + Intronic
1131118234 15:89807156-89807178 CGGCAGGGAGGGGAACCTGGAGG - Intronic
1131507600 15:93031180-93031202 CACCTGGGAGGGGCAACTGTAGG + Intergenic
1132360910 15:101214600-101214622 TATGTTGGAGGGGGACCTGGTGG + Intronic
1132748634 16:1447304-1447326 CCTCGGGGAGGGGCAGCCGGGGG - Intronic
1133302504 16:4791256-4791278 CATCTGGAAGGTGCTCCCGGTGG + Intronic
1133813484 16:9178884-9178906 CCTCCAGGAAGGGCACCTGGAGG - Intergenic
1134062457 16:11207387-11207409 CATCTGGGAAGGCTTCCTGGAGG - Intergenic
1134423693 16:14118085-14118107 CATCTGGGAGAGGCACACAGGGG - Intronic
1136615048 16:31393445-31393467 CATCTGGGAGGGCAGGCTGGGGG + Intronic
1137540015 16:49355725-49355747 TTTCTGGGAGGGGCACATTGTGG - Intergenic
1137673236 16:50291440-50291462 CACGTGGCAGGGGCACCAGGTGG + Intronic
1137719331 16:50618718-50618740 ATGCTGGGAGGGGCCCCTGGCGG + Intronic
1138140457 16:54563871-54563893 CATCTGGTATTGACACCTGGTGG - Intergenic
1138445196 16:57059102-57059124 CATCAGCCAGGGGCACCTGTTGG - Intronic
1139474190 16:67194438-67194460 CCTCTGGGATGGGCACCTCCAGG - Exonic
1139971986 16:70782001-70782023 CATCTGGAAGGGGAATCAGGGGG + Exonic
1140272048 16:73474664-73474686 CAGCTGGGATGGAGACCTGGAGG - Intergenic
1140451297 16:75072883-75072905 CATCTCAGAGGGGAAGCTGGAGG - Intronic
1141281895 16:82636381-82636403 CATCTAGGATGGGCACCGTGGGG + Intronic
1141698010 16:85629376-85629398 CTTCAGGGCGGGTCACCTGGAGG + Intronic
1142230991 16:88900236-88900258 CCTCTGGGCGGCACACCTGGGGG + Intronic
1142625455 17:1188862-1188884 CTTCTGGGAGGGGCAGCCAGAGG - Intronic
1142639988 17:1280193-1280215 CATCTCCGAGGGGCACCTGGAGG + Exonic
1142644181 17:1301473-1301495 CAGCAGGGTGGGGAACCTGGTGG - Intergenic
1143014664 17:3885333-3885355 CATCTGAGATGGCCACGTGGTGG + Exonic
1143590963 17:7885544-7885566 CGTGGGGGAGGGGCACGTGGGGG + Intronic
1143617728 17:8063944-8063966 CCTCAGGGAGCGTCACCTGGAGG - Intergenic
1143681953 17:8482240-8482262 CTTTTGGAAGGGGCAGCTGGTGG - Intronic
1143919650 17:10320715-10320737 CAGCTGAGAGAGGCACCAGGAGG - Intronic
1144852817 17:18252498-18252520 CTTCTGGGAGGGTCACCAGGTGG + Exonic
1145251764 17:21300677-21300699 CAGCTGGGAGGGCTCCCTGGAGG + Intronic
1145810351 17:27760582-27760604 CAGGTGGGAGGGGCACCAGGGGG - Intronic
1145982251 17:29019968-29019990 CATTTGCGATCGGCACCTGGAGG + Intronic
1146374904 17:32287473-32287495 CATCTGGGATGGCCTGCTGGAGG + Intronic
1147402688 17:40190633-40190655 CCTCGGGGAGGGGCACCTGGTGG - Exonic
1148744495 17:49910745-49910767 AGTCTGGGAGGGCCACCTGGAGG - Intergenic
1151089010 17:71413783-71413805 AATCTGGGAGAGTCACTTGGGGG + Intergenic
1151519421 17:74617568-74617590 TTCCTGGGAGGGGAACCTGGAGG + Intronic
1151627226 17:75284524-75284546 CAGCTGGCGGCGGCACCTGGTGG + Intronic
1151825035 17:76519332-76519354 CACCAGGGAGGGGCAGCTGAGGG - Intergenic
1152554534 17:81046344-81046366 CAGCTGGGAGGGCTGCCTGGAGG - Intronic
1152574903 17:81135687-81135709 CATCTGGGAAGGCTGCCTGGAGG + Intronic
1152781871 17:82230351-82230373 AGTCTGGGGTGGGCACCTGGAGG + Intronic
1154032366 18:10765136-10765158 CATGTGGGAGGGACAGATGGAGG + Intronic
1156883803 18:42111258-42111280 CATCTGGAAGGTTCATCTGGGGG + Intergenic
1157440329 18:47706553-47706575 CTCCTGGGAGGGAAACCTGGGGG + Intergenic
1160096569 18:75878648-75878670 CATGTGTGGGAGGCACCTGGTGG + Intergenic
1160693383 19:470661-470683 CTGCTGGGAGGGGCGGCTGGAGG - Intronic
1161422501 19:4183574-4183596 CATCCGGGAGGGCTTCCTGGAGG + Intronic
1161459666 19:4389275-4389297 CATCTGGGTGGGGGACCCCGAGG + Intronic
1161512178 19:4677920-4677942 CATCTGGGCCAGGCAGCTGGCGG - Intronic
1162925702 19:13929785-13929807 GCTCGGGGATGGGCACCTGGAGG + Intronic
1162925716 19:13929815-13929837 GCTCGGGGATGGGCACCTGGAGG + Intronic
1162925741 19:13929875-13929897 GCTCGGGGATGGGCACCTGGAGG + Intronic
1162925755 19:13929905-13929927 GCTCGGGGATGGGCACCTGGAGG + Intronic
1162925769 19:13929935-13929957 GCTCGGGGATGGGCACCTGGAGG + Intronic
1162925783 19:13929965-13929987 GCTCGGGGATGGGCACCTGGCGG + Intronic
1162935043 19:13978053-13978075 CGTGTGGGACGGGCACCTGCTGG + Exonic
1163030242 19:14539435-14539457 CAGCTGTGACAGGCACCTGGTGG - Intronic
1163531264 19:17850338-17850360 GATCTGGGAGGGCTTCCTGGAGG + Intergenic
1163778502 19:19232369-19232391 CAGCAGCGCGGGGCACCTGGCGG + Intronic
1164682702 19:30146197-30146219 CTTCTGTGAGAGGCATCTGGCGG + Intergenic
1164886612 19:31783745-31783767 CAGCTGGGAGGCGGGCCTGGTGG - Intergenic
1165020238 19:32918224-32918246 CTTCTTGGAGGCGCTCCTGGTGG + Exonic
1165060549 19:33202981-33203003 CATCAGGTAGGGGCACCCGGGGG + Exonic
1165410131 19:35654751-35654773 CATCTGTGAGGGGCAGAGGGAGG + Intronic
1165439512 19:35816608-35816630 CATCTGGGAGGGGCTGCTCAAGG - Intergenic
1165749301 19:38250628-38250650 AATCTGGGAGGGCCTCCTGAAGG - Intronic
1165927613 19:39336651-39336673 AATCTAGGAAGGCCACCTGGAGG - Intronic
1166257245 19:41615300-41615322 TGTCTGGGAGGGGGAGCTGGTGG + Intronic
1166916450 19:46198851-46198873 CCCCTGGGAGGGGCTCCTTGAGG + Intergenic
1166919682 19:46220851-46220873 CATCTGGGAGAGACTCCTTGAGG + Intergenic
1166931578 19:46304412-46304434 CATCTGGGAGAGTCTCCTAGAGG - Intronic
1166994515 19:46713878-46713900 CATCCAGGAGGGCGACCTGGTGG - Exonic
1167097426 19:47381832-47381854 AATCTGGGAGGGCTTCCTGGAGG + Intronic
1167475285 19:49697060-49697082 CATCAGGGAGGGCTCCCTGGAGG - Intronic
1168123200 19:54266505-54266527 CAGCTGGGGGAGGCACCAGGTGG - Intronic
1168154577 19:54465545-54465567 CATCTGCGAGGGGCACGGGAGGG + Exonic
1168551855 19:57302725-57302747 CATCTGGGAGGGGTAGGTGGAGG + Intergenic
925037958 2:706330-706352 CATGTGGGAGGCCCACCTGAAGG + Intergenic
926724508 2:15986863-15986885 CATTTGGGAGGTGCAGATGGGGG + Intergenic
927943160 2:27118533-27118555 CCTGGGGGAGGGGCAGCTGGCGG - Intronic
928941622 2:36732819-36732841 TATCTGGGAGGGCTTCCTGGAGG + Intronic
929958270 2:46477338-46477360 CATCTCAGAGGGGCACCCAGTGG + Intronic
931167077 2:59759676-59759698 CATCAGGGAGGGCTTCCTGGTGG - Intergenic
932368570 2:71169133-71169155 CATATGGGAGGTGCACTTGCAGG - Intergenic
932415945 2:71574040-71574062 AACCTGGGAGGGCCACCTAGAGG - Intronic
932709253 2:74049743-74049765 GATCGGGGAGGGGTAGCTGGAGG - Intronic
934087745 2:88524666-88524688 CATGTGGCAAGGGCACCTGGAGG + Exonic
934575365 2:95397240-95397262 GATGTGGGAGGGGCAGCTGGAGG + Intergenic
934651317 2:96092695-96092717 CAGCTGGGAGGCTCACCTGCAGG + Intergenic
934852001 2:97707472-97707494 GCTCTGGGAGGGCCACATGGTGG - Intergenic
934985843 2:98884073-98884095 CAGGTGGGTGGGGCACCTGTGGG - Intronic
935397124 2:102620174-102620196 GATCTCGGGGGGACACCTGGAGG + Intronic
937094247 2:119225175-119225197 AATCAGCTAGGGGCACCTGGAGG + Intronic
938992374 2:136642821-136642843 CACCTGGGAGGTGGAACTGGAGG - Intergenic
941600509 2:167537519-167537541 AATCTGGGAGGGGTAACTGAAGG - Intergenic
942677149 2:178439348-178439370 TATCTGGGAAGGGGACCTGAAGG - Intronic
944090884 2:195910148-195910170 CACCTTGGAGGAGCACCTGAGGG - Exonic
947525541 2:230874780-230874802 CTTCTGGAGGGGGCTCCTGGAGG - Intronic
947719831 2:232363656-232363678 GGTCAGGGAGGGGCACCGGGAGG - Intergenic
948384719 2:237574482-237574504 CCCCTGGGAAGGGCAGCTGGGGG - Exonic
948395240 2:237640540-237640562 CATCTGGGGGGTGGTCCTGGGGG - Intronic
1171148156 20:22803721-22803743 CATCAGGGAGGGGCAGCTTAAGG + Intergenic
1172124732 20:32618827-32618849 CAGCTGGGTGGGGCTCCTGGTGG + Intergenic
1173855106 20:46245280-46245302 CATCTGAGAGGGCTGCCTGGAGG - Intronic
1174078889 20:47957175-47957197 CACCAGGCAGGGGCACCTGGAGG - Intergenic
1174171348 20:48619935-48619957 CCACTGGGAGGGGCACAGGGTGG + Intergenic
1174279617 20:49429640-49429662 TATCTGGGAGAGTTACCTGGAGG - Intronic
1175077099 20:56384987-56385009 CATGTGACAGGGGCATCTGGAGG - Intronic
1175625398 20:60484896-60484918 CATCTAGCAGGGGTACCTGGGGG - Intergenic
1176065405 20:63191697-63191719 TATCTGGGAGGCGACCCTGGTGG - Intergenic
1178943348 21:36925699-36925721 TCACTGGGAGGGGCAGCTGGCGG - Intronic
1179559169 21:42201938-42201960 CCCCAGGGTGGGGCACCTGGAGG - Intronic
1179787876 21:43740119-43740141 CATCTGGGGGGTGCACCTGGGGG - Intronic
1180072024 21:45441415-45441437 CACCTGGGATGGGCATGTGGGGG - Intronic
1180800650 22:18630402-18630424 CATCTTGGAGCTGCTCCTGGAGG - Intergenic
1180851882 22:19025959-19025981 CATCTTGGAGCTGCTCCTGGAGG - Intergenic
1180949800 22:19715821-19715843 TCTCTGGGAGGGGCCCCTTGGGG + Intronic
1181044220 22:20207008-20207030 CTTCTGAGAGGGCCACCGGGTGG + Intergenic
1181161890 22:20964555-20964577 GATCAGGGAGGGCCTCCTGGAGG + Intergenic
1181221069 22:21364860-21364882 CATCTTGGAGCTGCTCCTGGAGG + Intergenic
1181221410 22:21366683-21366705 CACCATGGAGGGCCACCTGGCGG + Intergenic
1181239721 22:21469564-21469586 CAACTCGGGCGGGCACCTGGGGG - Intergenic
1181469506 22:23129109-23129131 CCTCTGGGTGGGGGGCCTGGGGG - Intronic
1181672478 22:24432206-24432228 TGACTGGCAGGGGCACCTGGAGG + Exonic
1181704966 22:24644485-24644507 CAACTGGGAGGGGCAGAGGGAGG + Intergenic
1181773056 22:25140631-25140653 ATCCTGGGAGGGGCACCTCGGGG + Intronic
1181856072 22:25782454-25782476 CATCTTGGAGGGCCTCCTGGAGG + Intronic
1182451987 22:30427164-30427186 CTTCAGGGCTGGGCACCTGGTGG - Exonic
1182452426 22:30429382-30429404 CCTCTGGGAGGGGAGCCTGTTGG + Intergenic
1183353309 22:37345270-37345292 CATCTGGGAAGGCTTCCTGGAGG - Intergenic
1183365822 22:37406420-37406442 CGCCAGGGAGGGTCACCTGGGGG - Intronic
1183408705 22:37642667-37642689 CAGCTGGGAGGGGGTCCAGGTGG + Intronic
1183432168 22:37772466-37772488 CATCTTGGGGAGCCACCTGGAGG + Intronic
1183687283 22:39368426-39368448 GCGCTGGGAGGGGCACCAGGCGG - Intronic
1183891608 22:40934410-40934432 CATCTTGGAGGGGCAGGGGGAGG + Intergenic
1184143649 22:42595313-42595335 CTGCTGGGAGGGGCCTCTGGAGG + Intronic
1184356912 22:43987505-43987527 CATGTGGTATGGGCACCAGGTGG + Intronic
1184540814 22:45123048-45123070 CCTCTGTGAGGGGCAGCTTGAGG - Intergenic
1184653320 22:45929178-45929200 CATCTGGGAGGACTCCCTGGAGG - Intronic
1185099563 22:48830391-48830413 CCCCTTTGAGGGGCACCTGGAGG - Intronic
1185128840 22:49026017-49026039 CAGCTGGGTGGGGTCCCTGGGGG + Intergenic
1185132530 22:49047253-49047275 GATCTGGGAGGGCTCCCTGGAGG - Intergenic
951826757 3:26876606-26876628 CATCTGGCAGGGGCCCCTCTGGG + Intergenic
952338290 3:32423825-32423847 CATCTGTGACCTGCACCTGGGGG - Intronic
954624730 3:52016253-52016275 CATGTGGGACTGGCACCGGGGGG + Intergenic
955349084 3:58180723-58180745 CATCAGGGTGGGGCAGCAGGAGG - Intergenic
955507291 3:59645048-59645070 CATCTGGGAAAGGCAGCTGGTGG + Intergenic
956838152 3:73112669-73112691 CATCTGGGAGGCAGATCTGGGGG - Intergenic
958066057 3:88545719-88545741 GATTTGGGAGGGGCCACTGGTGG + Intergenic
958816977 3:98927669-98927691 CAACTGGGAGTGGCACCGAGAGG + Intergenic
960007757 3:112798300-112798322 AATCAGGGAGGGGCACATAGAGG + Intronic
960486613 3:118260012-118260034 GATGTGGGAGGGGCACAGGGTGG + Intergenic
961298977 3:125909749-125909771 TATCTGGAAGGGGCATCTTGGGG - Intergenic
961446049 3:126982367-126982389 CATCCGGGAGGGCCTCCCGGTGG - Intergenic
961832234 3:129629168-129629190 GATCTGGGCAGGGCACATGGAGG + Intergenic
962243568 3:133772016-133772038 CATCTGGGAAGGCTTCCTGGAGG - Intronic
962425887 3:135269046-135269068 CAGCTGGGCAGGGCACCTGGTGG + Intergenic
963812171 3:149788721-149788743 CATCTGGGGAGGGAAACTGGGGG + Intronic
966255225 3:177909229-177909251 CATCTGGCAGGGGCCCCTCTGGG + Intergenic
967687452 3:192434191-192434213 GTTCTGGGAGGGGCTCCCGGAGG - Intronic
968404343 4:327107-327129 AATATGGGTGGGGCAGCTGGAGG - Intergenic
968574981 4:1361551-1361573 CGTGCGGGAAGGGCACCTGGCGG - Intronic
968661243 4:1799676-1799698 CATCTGGGAGGGGCACCTGGGGG + Intronic
968705623 4:2076097-2076119 GCCCTGGGAGGGGCACCTGAGGG - Intronic
969239950 4:5891347-5891369 TATCTGGGAGGGCTTCCTGGAGG - Intronic
969525687 4:7702847-7702869 CATCAGGGAGGGCTTCCTGGAGG + Intronic
969676371 4:8616548-8616570 CATCAGGGAGGGCTTCCTGGAGG + Intronic
969815663 4:9685548-9685570 TATCTGGAAGGGGCATCTTGGGG - Intergenic
972219402 4:36936377-36936399 CATCTGGCAGGGGCCCCTCTGGG + Intergenic
972632910 4:40857275-40857297 CATCTGGCGGGAGCACCTAGCGG - Intronic
973654384 4:53031045-53031067 CATCTGGTAGGTGCCCCTGTGGG + Intronic
975245952 4:72120516-72120538 CATCTGGCAGGGGCCCCTCTGGG + Intronic
976747198 4:88415073-88415095 CTTCTGGGAGGGGAACTGGGTGG - Intronic
984853539 4:184173924-184173946 CATCCCGGGGGGACACCTGGTGG + Intronic
985359652 4:189159104-189159126 CTGTTGGGAGGGGGACCTGGTGG - Intergenic
985508581 5:299038-299060 CAGCTGGGGGGAGCAGCTGGGGG - Intronic
985508635 5:299203-299225 CAGCTGGGGGGAGCAGCTGGGGG - Intronic
985664887 5:1176927-1176949 GACCTGGAAAGGGCACCTGGGGG + Intergenic
985687244 5:1289144-1289166 CACCTGAGAGGGACACCCGGGGG + Intronic
985739572 5:1607011-1607033 CAGCTGGGGGGAGCAGCTGGGGG + Intergenic
986002838 5:3643517-3643539 CATCTGGAGGGGGCAGGTGGGGG - Intergenic
987204388 5:15610142-15610164 GTTCTGGGAGGGACCCCTGGTGG - Intronic
987776322 5:22372340-22372362 CAGCTGGGAGAAGCTCCTGGAGG + Intronic
991012891 5:61902084-61902106 CATCAGTGAGGGCAACCTGGAGG - Intergenic
994488431 5:100409657-100409679 CATCTGAGAGTGGAAACTGGGGG - Intergenic
996967493 5:129322604-129322626 CATCTGAGAAAGCCACCTGGAGG - Intergenic
997354254 5:133252299-133252321 CATCGGGGAGGGGCTCTTGGAGG + Intronic
997589014 5:135061691-135061713 CATCTGGGGGTGGCACAGGGAGG - Intronic
999871275 5:155753848-155753870 CATTTGGGAGGAGGACCTGGGGG - Intergenic
1001288214 5:170438779-170438801 CATCAGGGAGGGCTTCCTGGAGG - Intronic
1001688182 5:173611364-173611386 CACCTGGGGAGAGCACCTGGGGG + Intronic
1004059004 6:12172072-12172094 CATCTGGGAGAAGGACCAGGCGG + Intergenic
1005378323 6:25207767-25207789 CCTGTGGGAGGGGCAGCTGTGGG + Intergenic
1006793252 6:36717088-36717110 CATCTGGGAATGGTTCCTGGAGG + Intronic
1007395544 6:41575746-41575768 CAGCAGGGAGGGGCTCCTGGGGG - Intronic
1007399760 6:41597169-41597191 CACCAGGGTGGGGCTCCTGGAGG - Exonic
1008605330 6:53134010-53134032 CATCTGGCAGGGGCATCTGAGGG + Intronic
1008885466 6:56427943-56427965 CATGTGAGGGGGGCATCTGGAGG - Intergenic
1015732986 6:136367305-136367327 CAGGTGGGAGGGGCACGTGCTGG + Intronic
1016108036 6:140187398-140187420 CATCTGTGGGAGGCACTTGGTGG + Intergenic
1016684815 6:146869104-146869126 CTTCTGGCTGTGGCACCTGGTGG - Intergenic
1017516883 6:155164530-155164552 CAGCTTGGAGGGGCGGCTGGCGG - Exonic
1019195624 6:170280912-170280934 CAGCTGGGAGTGGCCCATGGGGG - Intergenic
1019195916 6:170283189-170283211 CATCAGGAGGGGGTACCTGGGGG - Intronic
1019561539 7:1661547-1661569 CATTTGGGAGGAGTATCTGGAGG + Intergenic
1019644706 7:2122886-2122908 CACCTGGGAGGGGCGCTGGGTGG - Intronic
1019937296 7:4264923-4264945 GATCAGGGAGGGGGACCTGGGGG + Intronic
1020104794 7:5417725-5417747 AATCTGGAAGGGCCACTTGGTGG - Intronic
1023828899 7:44028112-44028134 CCTATGGGAGGGGGAGCTGGTGG + Intergenic
1023960369 7:44921591-44921613 CATCTAGGAAGAGCACCTGGGGG + Intergenic
1023960519 7:44922283-44922305 CATCAGGGACGGCCACCAGGGGG - Intergenic
1024838911 7:53560659-53560681 CATGTGGAGGGGGGACCTGGTGG + Intergenic
1025250333 7:57347488-57347510 ATTCTGGGAGGGCCTCCTGGTGG + Intergenic
1025977182 7:66378484-66378506 CATCTGGGGTGGCCACCTTGAGG + Intronic
1028630185 7:92926063-92926085 CATCTGGCAGGGGCCCCTCTGGG - Intergenic
1029381102 7:100215347-100215369 CATCTGGGAGGGGCAGGTGGGGG - Intronic
1029400478 7:100342296-100342318 CATCTGGGAGGGGCAGGTGGGGG - Intronic
1029450711 7:100640696-100640718 CCTGGGGGAGGGGCGCCTGGAGG - Exonic
1029458438 7:100682570-100682592 CAGGTGGGCGTGGCACCTGGAGG - Exonic
1029739199 7:102482369-102482391 CCTATGGGAGGGGGAGCTGGTGG + Intergenic
1029757200 7:102581548-102581570 CCTATGGGAGGGGGAGCTGGTGG + Exonic
1029775140 7:102680609-102680631 CCTATGGGAGGGGGAGCTGGTGG + Intergenic
1030131449 7:106205218-106205240 CTCCTGGGAGGGGAAGCTGGAGG - Intergenic
1030686875 7:112496158-112496180 CAACTGGGAGCTGCAACTGGAGG + Intergenic
1032463652 7:132129858-132129880 CAGCTGGGAGGTGCTCCTTGAGG - Exonic
1033155668 7:138954880-138954902 CATCTGGAAGGGGGACCCAGGGG + Intronic
1034441878 7:151089809-151089831 CAGCTGGGAGGGAGAGCTGGAGG + Intronic
1034946640 7:155266696-155266718 AAGCTGGGAGGGGCAGCTGGAGG + Intergenic
1035037583 7:155905417-155905439 CATCTCCCAGGGGCTCCTGGAGG - Intergenic
1035554354 8:555057-555079 CTTCTGGGAGGGGGCCCTAGGGG - Intergenic
1037468625 8:19185494-19185516 CAGCTGGCAGGGGAGCCTGGGGG - Intergenic
1037992121 8:23328511-23328533 CATCGGGGAGGGCCGCGTGGAGG - Exonic
1039926801 8:41941274-41941296 CATCTCGGAGGGGCCGCTGGGGG - Exonic
1041920671 8:63179726-63179748 CATCTGGGAGGTGTACCCAGCGG - Intronic
1046373787 8:113348602-113348624 CATGTGGGAGGGACAGGTGGGGG + Intronic
1047207866 8:122817942-122817964 AATCTGGGAAGGCCTCCTGGAGG - Intronic
1048880843 8:138871275-138871297 CAGCTCGGAGGGGCATCCGGGGG - Intronic
1049365223 8:142233805-142233827 CATCTGGGAAGGCATCCTGGAGG - Intronic
1049435586 8:142584714-142584736 CATCTGGGTGGGACACAGGGTGG + Intergenic
1050404562 9:5293771-5293793 CATCTGGGAGGTGCCCCTCTGGG + Intergenic
1050690516 9:8222247-8222269 CATGATGGAGGGCCACCTGGGGG - Intergenic
1053234836 9:36443957-36443979 CTTCTGGGAGGGGAACATGCTGG - Intronic
1053425604 9:38008086-38008108 CATGTGACAGGAGCACCTGGAGG + Intronic
1056577436 9:87867269-87867291 CATCAGGGAGGGCCTCCAGGAGG + Intergenic
1056661143 9:88544254-88544276 AGGCTGGGTGGGGCACCTGGTGG + Intronic
1057083444 9:92189250-92189272 CAGCTGGGAGGGGGAGCTGCGGG + Intergenic
1057884736 9:98821755-98821777 AATCTGGGAGGGGCACTTAGAGG - Intronic
1058841079 9:108909729-108909751 CATAGGTCAGGGGCACCTGGAGG - Intronic
1061035179 9:128109526-128109548 AGGCTGGGAGGGGCAGCTGGGGG - Intergenic
1061056673 9:128226338-128226360 CTTCTGGGATGGGGGCCTGGAGG - Intronic
1061303140 9:129717956-129717978 GATCAGGGAGGGCCCCCTGGAGG + Intronic
1061368772 9:130186332-130186354 CATCTGGGAGGGCTTCCTGGAGG + Intronic
1061385272 9:130285874-130285896 CATCTCAGAGTGGCCCCTGGAGG - Intronic
1061419714 9:130466623-130466645 CTCCTGGGAGGGGCCCATGGGGG - Intronic
1061485440 9:130918275-130918297 TATCTGGGAGGGCTCCCTGGAGG + Intronic
1061777253 9:132973605-132973627 CGTCTGGGAGGGCTTCCTGGAGG + Intronic
1061881592 9:133571742-133571764 CTTCTGAGAGGGGGACCTGGGGG + Intronic
1062017090 9:134296444-134296466 GACCTGGGAGGGGGAGCTGGGGG + Intergenic
1062389436 9:136328036-136328058 CACCTGGCAGGGGCACCGTGGGG + Intronic
1062519623 9:136952219-136952241 CCCTTGGGAGGGGCACCTGCTGG + Intronic
1062527504 9:136984249-136984271 TGTCTGGAAGGGGGACCTGGAGG + Intronic
1062543269 9:137050886-137050908 CAGGGTGGAGGGGCACCTGGAGG + Exonic
1062565227 9:137161365-137161387 CACCTACGAGGTGCACCTGGTGG + Exonic
1062600531 9:137316911-137316933 TATGTGGGAGGGGCACGTTGTGG + Intronic
1062697568 9:137883277-137883299 GGTCTGGGAGGGGCACTTGGCGG + Intronic
1189145943 X:38654888-38654910 CATCAGGGAAGGGCTCATGGAGG + Intronic
1189386291 X:40539569-40539591 CTCCTTGGAGGGGAACCTGGCGG - Intergenic
1191175133 X:57491347-57491369 CATCTGGCAGGTGCCCCTTGGGG + Intergenic
1191641695 X:63433965-63433987 CATCTGAGAGGGGTGTCTGGAGG + Intergenic
1192053435 X:67747671-67747693 CTTCTGGGAGGGACAGTTGGAGG + Intergenic
1192598639 X:72438103-72438125 CATCTGGCAGGGGCCCCTCTGGG + Intronic
1192763315 X:74118842-74118864 CATTTGGGAGGGTGCCCTGGTGG - Intergenic
1195301487 X:103534303-103534325 CAACTGGGAGGGACAGATGGAGG + Intergenic
1197051273 X:122061796-122061818 CATCTGGCAGGTGCACCTCTGGG + Intergenic
1199880689 X:151972514-151972536 CATCTGGGAGGGGCTGCTTCAGG - Intronic
1200236667 X:154471039-154471061 CACATGGGAGGGGCCCCTTGGGG + Intronic
1200244993 X:154518281-154518303 AAGCTGGGAGGGGCACCTGCCGG + Intergenic
1200835385 Y:7726896-7726918 CAGCCGGGAGGGGTGCCTGGGGG + Intergenic