ID: 968661890

View in Genome Browser
Species Human (GRCh38)
Location 4:1802086-1802108
Sequence TCACGCAACCCGCAGCCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 52}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968661890_968661903 9 Left 968661890 4:1802086-1802108 CCCCTTGGCTGCGGGTTGCGTGA 0: 1
1: 0
2: 0
3: 0
4: 52
Right 968661903 4:1802118-1802140 TCTAGGGGTTGGAGCTTCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 85
968661890_968661901 7 Left 968661890 4:1802086-1802108 CCCCTTGGCTGCGGGTTGCGTGA 0: 1
1: 0
2: 0
3: 0
4: 52
Right 968661901 4:1802116-1802138 GGTCTAGGGGTTGGAGCTTCGGG 0: 1
1: 0
2: 1
3: 15
4: 138
968661890_968661907 24 Left 968661890 4:1802086-1802108 CCCCTTGGCTGCGGGTTGCGTGA 0: 1
1: 0
2: 0
3: 0
4: 52
Right 968661907 4:1802133-1802155 TTCGGGGGCAGAAGCTGTGGGGG 0: 1
1: 0
2: 1
3: 14
4: 227
968661890_968661900 6 Left 968661890 4:1802086-1802108 CCCCTTGGCTGCGGGTTGCGTGA 0: 1
1: 0
2: 0
3: 0
4: 52
Right 968661900 4:1802115-1802137 GGGTCTAGGGGTTGGAGCTTCGG 0: 1
1: 1
2: 1
3: 18
4: 188
968661890_968661905 22 Left 968661890 4:1802086-1802108 CCCCTTGGCTGCGGGTTGCGTGA 0: 1
1: 0
2: 0
3: 0
4: 52
Right 968661905 4:1802131-1802153 GCTTCGGGGGCAGAAGCTGTGGG 0: 1
1: 0
2: 1
3: 23
4: 162
968661890_968661898 -6 Left 968661890 4:1802086-1802108 CCCCTTGGCTGCGGGTTGCGTGA 0: 1
1: 0
2: 0
3: 0
4: 52
Right 968661898 4:1802103-1802125 GCGTGAGGATTTGGGTCTAGGGG 0: 1
1: 0
2: 0
3: 1
4: 66
968661890_968661896 -8 Left 968661890 4:1802086-1802108 CCCCTTGGCTGCGGGTTGCGTGA 0: 1
1: 0
2: 0
3: 0
4: 52
Right 968661896 4:1802101-1802123 TTGCGTGAGGATTTGGGTCTAGG 0: 1
1: 0
2: 2
3: 4
4: 104
968661890_968661906 23 Left 968661890 4:1802086-1802108 CCCCTTGGCTGCGGGTTGCGTGA 0: 1
1: 0
2: 0
3: 0
4: 52
Right 968661906 4:1802132-1802154 CTTCGGGGGCAGAAGCTGTGGGG 0: 1
1: 0
2: 1
3: 17
4: 166
968661890_968661897 -7 Left 968661890 4:1802086-1802108 CCCCTTGGCTGCGGGTTGCGTGA 0: 1
1: 0
2: 0
3: 0
4: 52
Right 968661897 4:1802102-1802124 TGCGTGAGGATTTGGGTCTAGGG 0: 1
1: 0
2: 0
3: 3
4: 77
968661890_968661904 21 Left 968661890 4:1802086-1802108 CCCCTTGGCTGCGGGTTGCGTGA 0: 1
1: 0
2: 0
3: 0
4: 52
Right 968661904 4:1802130-1802152 AGCTTCGGGGGCAGAAGCTGTGG 0: 1
1: 0
2: 3
3: 19
4: 357
968661890_968661902 8 Left 968661890 4:1802086-1802108 CCCCTTGGCTGCGGGTTGCGTGA 0: 1
1: 0
2: 0
3: 0
4: 52
Right 968661902 4:1802117-1802139 GTCTAGGGGTTGGAGCTTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 97
968661890_968661899 -2 Left 968661890 4:1802086-1802108 CCCCTTGGCTGCGGGTTGCGTGA 0: 1
1: 0
2: 0
3: 0
4: 52
Right 968661899 4:1802107-1802129 GAGGATTTGGGTCTAGGGGTTGG 0: 1
1: 0
2: 0
3: 22
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968661890 Original CRISPR TCACGCAACCCGCAGCCAAG GGG (reversed) Intronic
901158475 1:7156317-7156339 TCAAGGAACCCCCAGCCTAGTGG + Intronic
911003447 1:93192266-93192288 ACATGCAACCTACAGCCAAGAGG - Intronic
915321687 1:155060061-155060083 TCAGGGAACCAGCAGCAAAGGGG - Intronic
918839200 1:189513032-189513054 TCAGGCAGTCTGCAGCCAAGTGG - Intergenic
1062911054 10:1212703-1212725 GCAGGCACCCTGCAGCCAAGTGG + Intronic
1062911065 10:1212747-1212769 GCAGGCACCCTGCAGCCAAGTGG + Intronic
1062911086 10:1212835-1212857 GCAGGCACCCTGCAGCCAAGCGG + Intronic
1062911098 10:1212879-1212901 GCAGGCACCCTGCAGCCAAGCGG + Intronic
1070662383 10:78316581-78316603 TCACTGCACCAGCAGCCAAGAGG - Intergenic
1073326389 10:102646028-102646050 TCACCCAGCCGGCAGCCCAGGGG - Intronic
1083310448 11:61781031-61781053 ACACGCACCCAGCAGCAAAGAGG - Exonic
1083365914 11:62141337-62141359 TCACCCAACCCTCACCCCAGTGG - Intronic
1085532074 11:77197837-77197859 CCAAGCATCCCGCAGGCAAGAGG - Intronic
1086649508 11:89270340-89270362 CCACTCAACCCTCATCCAAGTGG + Intronic
1089501099 11:118931696-118931718 TCACACAGCCTGCAGCCTAGTGG + Intronic
1091597084 12:1885395-1885417 GCCCGCAGCCCGCAGCCCAGGGG + Intronic
1099709990 12:86211545-86211567 TCACCCAGCCCGCAGCACAGTGG - Intronic
1119872588 14:78029967-78029989 TCACAGCAGCCGCAGCCAAGGGG - Intergenic
1122844119 14:104481458-104481480 CCTCTCAACCCCCAGCCAAGTGG + Intronic
1131244821 15:90781761-90781783 TCATCCAACCCGCAGCCCACGGG - Intronic
1134065643 16:11226242-11226264 TCAGGCAACCCTCTCCCAAGAGG - Intergenic
1150571258 17:66389113-66389135 CCACGCAACTTGCAGCCACGAGG + Intronic
1153839234 18:8990948-8990970 TCATGAAACCCACAGGCAAGTGG - Intergenic
1155633330 18:27921653-27921675 TCACACAGCCAGCAGCCTAGAGG + Intergenic
927642629 2:24855111-24855133 TCACACAGCCCAGAGCCAAGGGG - Intronic
931257674 2:60587662-60587684 TCAGGCCAACTGCAGCCAAGTGG + Intergenic
937299202 2:120828582-120828604 TCACCCAACCCACAGCCCGGAGG + Intronic
937336487 2:121065552-121065574 GCAAGCCACCAGCAGCCAAGGGG + Intergenic
948597562 2:239090047-239090069 CCACGCAGCCCACAGCCAGGCGG + Exonic
1171317559 20:24208965-24208987 ACACCCATCCTGCAGCCAAGGGG + Intergenic
1180934877 22:19618827-19618849 CCACGCACCTCGCAGCCCAGAGG - Intergenic
1182285692 22:29245542-29245564 TCATGCAGCCCCCAGCCCAGTGG - Intronic
950805702 3:15601488-15601510 TCACGCAGCCGGCAAACAAGCGG + Exonic
960155127 3:114291315-114291337 GCCCGCAGCCCTCAGCCAAGCGG - Intronic
962293050 3:134153750-134153772 TCAAGGAACTCACAGCCAAGTGG + Intronic
968562330 4:1290495-1290517 TCACGCAACCGGCAGCCGGACGG - Intronic
968661890 4:1802086-1802108 TCACGCAACCCGCAGCCAAGGGG - Intronic
969600346 4:8172389-8172411 ACACGCAACCCGCAGGCTGGCGG + Intergenic
973013069 4:45101684-45101706 TCAAGTAACCCACAGCAAAGAGG - Intergenic
993440566 5:87951931-87951953 TCACGCAACCTGCAACTAACTGG + Intergenic
1001568972 5:172717944-172717966 TCATGCAACTGGCATCCAAGAGG + Intergenic
1002684457 5:180997294-180997316 TCCCCCAGCCCACAGCCAAGTGG + Exonic
1006399347 6:33807432-33807454 TCACACAGCCTGCAGCCCAGAGG - Intergenic
1013075992 6:106772290-106772312 TCCAGCAGCCCGGAGCCAAGGGG - Intergenic
1015158919 6:130129565-130129587 GCACACAACCCGAAACCAAGTGG + Intronic
1023643828 7:42288527-42288549 TCAAACAACCCACAGCCTAGTGG + Intergenic
1041395586 8:57387754-57387776 TCAGGCAACCATCAGCCAATAGG + Intergenic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1044433317 8:92134205-92134227 TTAGGCCACCAGCAGCCAAGGGG - Intergenic
1052719798 9:32160273-32160295 TTACCCAACCCGCATTCAAGAGG + Intergenic
1056828150 9:89890992-89891014 CCACTCAACCAGGAGCCAAGGGG - Intergenic
1185809006 X:3087733-3087755 TAATGCAACCACCAGCCAAGGGG - Intronic
1191034346 X:56008604-56008626 TCAGGCAGTCCCCAGCCAAGTGG - Intergenic