ID: 968662539

View in Genome Browser
Species Human (GRCh38)
Location 4:1804748-1804770
Sequence GTACAGCCGGGGGTCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968662539_968662545 1 Left 968662539 4:1804748-1804770 CCAGCACTGACCCCCGGCTGTAC 0: 1
1: 0
2: 0
3: 11
4: 117
Right 968662545 4:1804772-1804794 TCCACGCCCTGTCGCCCACGCGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968662539 Original CRISPR GTACAGCCGGGGGTCAGTGC TGG (reversed) Intronic
900581416 1:3411719-3411741 GGGAAGCCGGGGGTGAGTGCGGG - Exonic
900680616 1:3914394-3914416 GGAAAGCCAGGGGTCTGTGCGGG + Intergenic
901200509 1:7464547-7464569 CTAGAGCCTGGGGTCAGGGCTGG + Intronic
915590757 1:156868861-156868883 GTATAGCCTGGGGTCCCTGCTGG - Intronic
919148876 1:193669525-193669547 GCACAGCAGGAGGTCAGTGGAGG + Intergenic
924038353 1:239958228-239958250 GTAGAGGCGTGGGTCATTGCTGG - Intergenic
1067533065 10:47088420-47088442 GTTCAACAGGGGTTCAGTGCAGG - Intergenic
1072083543 10:92056770-92056792 GTGCAGCCTGGGGTTAGGGCAGG - Intronic
1072635587 10:97175800-97175822 GTGCAGGCGGAGGTCAGTGGCGG - Intronic
1075443116 10:122494820-122494842 GTTCAGACGGGGGTCACTGCGGG + Intronic
1077061574 11:619994-620016 GTAGGGCGGGGGGTCAGGGCTGG - Intronic
1079027656 11:16961532-16961554 GCACAGCCAGGGGTGGGTGCAGG - Intronic
1081812993 11:45923556-45923578 GTACAGCCAGGTGTCCGTGGAGG + Intronic
1082790871 11:57346050-57346072 GTACAGCCGTGGGCCAAGGCTGG + Intronic
1083266618 11:61549961-61549983 TTACAGCCGCGGGCCAGGGCTGG - Intronic
1083275787 11:61596259-61596281 GGGCAGCCAGGCGTCAGTGCAGG - Intergenic
1083304822 11:61756723-61756745 GGAGGGCCTGGGGTCAGTGCAGG + Intronic
1085128076 11:74015486-74015508 GTACAGCTGGGGGTCAGGAATGG - Intronic
1086413974 11:86570467-86570489 ATAAAGCTGGGGTTCAGTGCAGG - Intronic
1087691099 11:101321229-101321251 GTACAGCCTGGGGTTAGTGGAGG + Intergenic
1097031904 12:56095894-56095916 GTGCACCCAGGGGTCAGTGATGG + Intronic
1097168219 12:57096918-57096940 GCAGAGCAGGGGGTCAGGGCTGG + Exonic
1097488211 12:60232742-60232764 GCACAGCAGGAGGTCAGTGGTGG + Intergenic
1103062858 12:117872997-117873019 GGGCAGCCAGGGTTCAGTGCGGG + Intronic
1103339113 12:120211945-120211967 GTGCAGCCGGGGGGCAGGGAAGG - Exonic
1103714408 12:122935587-122935609 GTACAGGCGGGAGTCACTGTTGG - Intronic
1108640421 13:52378171-52378193 GAGCAGCCCGCGGTCAGTGCCGG - Exonic
1121413169 14:93761801-93761823 GTCCAGCGGGAGGTCACTGCAGG - Intronic
1123154271 14:106209448-106209470 CTGCAGCCGGGGGTCTCTGCAGG + Intergenic
1124423128 15:29539521-29539543 GTACAGCCAGGGTTGAGTGGTGG - Intronic
1126716609 15:51524941-51524963 GTACAGCCTGGGGTTAGGGAAGG - Intronic
1129410226 15:75346925-75346947 GTATAGCTGCGGGTTAGTGCTGG - Intergenic
1129610754 15:77053938-77053960 GTACAGACTGGGGTCAGGGAAGG + Intronic
1130092270 15:80830985-80831007 GAACTCCAGGGGGTCAGTGCTGG - Intronic
1132688181 16:1170972-1170994 GTACAGCCAGGTGTCAGGACAGG + Intronic
1132767668 16:1542597-1542619 GGTCAGCCTGGGGTCAGCGCAGG + Intronic
1133908557 16:10043636-10043658 GTACAGTGGGGGTTCAGAGCAGG - Intronic
1135656708 16:24256444-24256466 GTAAAGACGAGGGTCCGTGCAGG - Exonic
1138656772 16:58495961-58495983 GGACAGCCGGAGATCAGGGCAGG + Intronic
1142618140 17:1148528-1148550 GCACAGCCGGAGGTGAGTGGTGG + Intronic
1144516027 17:15917943-15917965 GGACAGCCCGGGCCCAGTGCAGG - Intergenic
1144786077 17:17832376-17832398 GGACAGTCGGGGGTCAGAGCAGG - Intronic
1145086579 17:19947102-19947124 GTCCATCCGGTGGTCTGTGCCGG + Intronic
1148060754 17:44834709-44834731 GTAGAGACGGGGTTTAGTGCTGG - Intergenic
1148090011 17:45017873-45017895 GGACAGCTGGGGGGTAGTGCTGG + Intergenic
1151938859 17:77280919-77280941 GCACAGCCGGGGGTCGGAGCCGG - Intronic
1152041677 17:77907688-77907710 GACCGGCCGGGGGTCAGTGCAGG + Intergenic
1152339474 17:79716270-79716292 GTAGAGCCGTGGGGCAGTGTGGG + Intergenic
1152751641 17:82065194-82065216 CTAAAGGCGGGGGTCGGTGCAGG + Exonic
1155109271 18:22697822-22697844 GCACAGCAGGGAGTGAGTGCAGG + Intergenic
1156034094 18:32747637-32747659 GTACAGCAGGAGGTGAGTGGTGG - Intronic
1159719269 18:71865952-71865974 GCACAGCTGGGGGTGAGTGTGGG + Intergenic
1160724090 19:610043-610065 GTACTGTGGGGGGTCAGGGCTGG - Intronic
1160844318 19:1159794-1159816 GAACAGCGGGGGGACAGTGGGGG + Intronic
1161156548 19:2734798-2734820 CTCCAGCCGGTGGTCAGTGAGGG - Intronic
1162738219 19:12758264-12758286 GTAGAGCTGGTGGTCAGGGCGGG - Exonic
1165307662 19:35012206-35012228 CTACAGCCGGGGGGCAGAGGGGG - Intronic
1165712869 19:38024533-38024555 GGCCAGCTGGGGGGCAGTGCCGG - Intronic
1166179301 19:41095681-41095703 GTGCAGCCGGGGGTCAGTAGGGG + Intronic
1166772240 19:45290842-45290864 GCAGAGCCCGGGGTCAGTACAGG + Intronic
925313227 2:2902706-2902728 ATACAGAGAGGGGTCAGTGCAGG - Intergenic
926140544 2:10365426-10365448 GGACAGCCCGGAGTCTGTGCAGG + Intronic
927347938 2:22069581-22069603 GTACAGCCGGGGGTTAGGGGAGG - Intergenic
929346198 2:40887555-40887577 GCACAGCAGGGGGTGAGTGCTGG + Intergenic
932402413 2:71490090-71490112 GTACAGCCGGGTGTCCATACGGG - Intronic
933773774 2:85759574-85759596 GTCCAGCCTGGTGGCAGTGCAGG + Intronic
948287656 2:236799021-236799043 CCACAGCCAGGGGTCAGGGCTGG - Intergenic
948350840 2:237339715-237339737 GTGCAGCCCAGGGTCAGTACAGG - Intronic
948595944 2:239079370-239079392 GCACAGCCCGGGCTCACTGCCGG + Intronic
1172391601 20:34568827-34568849 GTACAGGGAGGGGTCAGGGCTGG + Intronic
1172872903 20:38146967-38146989 GTACAGCAGGGGGTGAAAGCTGG + Intronic
1173320996 20:41986770-41986792 GTTCATCTGGTGGTCAGTGCTGG - Intergenic
1174411644 20:50340428-50340450 GAAGGGCCGGGGGTCAGAGCAGG - Intergenic
1175909612 20:62398522-62398544 GTACTGCTGGGGGTCACTTCTGG + Intronic
1180030342 21:45202342-45202364 GAGCAGCTGGAGGTCAGTGCTGG + Intronic
1180042248 21:45286941-45286963 GCGGAGCCGGGAGTCAGTGCCGG - Intronic
1180245343 21:46543585-46543607 GTACAGCCCGGGGGCTGTGGAGG - Intronic
1181846808 22:25716811-25716833 GCACAGCAGGAGATCAGTGCTGG + Intronic
1182261122 22:29073433-29073455 CTGCAGCCGGGGGACAGTACCGG - Intronic
950120944 3:10482313-10482335 GTAGAGCTGGGTGCCAGTGCTGG - Intronic
950662091 3:14472926-14472948 GGACAGCCAGAGGTCAGGGCGGG - Intronic
951369289 3:21825839-21825861 GTACAGCAGGAGGTGAGCGCCGG + Intronic
953553508 3:43923796-43923818 GTACAGCCGAGGGGCAGTGATGG - Intergenic
958757902 3:98272084-98272106 GTGCAGCCTGGGGTTAGTGTAGG + Intergenic
963364980 3:144323378-144323400 GTACAGCCTGGGGTTAGAGGAGG - Intergenic
967361248 3:188634501-188634523 GCACAGCAGGTGGTCAGTGGCGG + Intronic
968662539 4:1804748-1804770 GTACAGCCGGGGGTCAGTGCTGG - Intronic
969196797 4:5569621-5569643 GTCCAGCCAGGGGCCTGTGCAGG + Intronic
971567894 4:28168479-28168501 GTACAGCCTGGGGTTAGGGGAGG + Intergenic
974671170 4:65032214-65032236 GTACAGCAGGAGATGAGTGCTGG - Intergenic
975502327 4:75100410-75100432 GTGCAGCCTGGGGTTAGTGGAGG + Intergenic
1202762307 4_GL000008v2_random:122793-122815 GGTCAGCTGGGGCTCAGTGCTGG - Intergenic
986649519 5:9949479-9949501 GTACAGCAGGAGGTGAGTGGTGG - Intergenic
987303214 5:16616067-16616089 GCACACCCGGGGGTGGGTGCTGG + Intronic
990309447 5:54524070-54524092 GAACAGCTGGGGGTAAATGCAGG - Intronic
991140816 5:63240245-63240267 GTCCAGCCAGGGGTAAGTGATGG + Intergenic
993968540 5:94388271-94388293 GTACAGCAGGAGGTGAGTGGCGG - Intronic
996504323 5:124252588-124252610 GAACAGCCTGGAGTGAGTGCTGG + Intergenic
1001646183 5:173283956-173283978 GCACAGCCGGCGGGCAGGGCTGG - Intergenic
1003989831 6:11474616-11474638 GGACAGCCGGAGCTCAGTGAGGG - Intergenic
1011204713 6:84879175-84879197 GTACATCTGGGTGCCAGTGCTGG - Intergenic
1012554347 6:100493356-100493378 GTATAGCCGCGGGGCAGAGCCGG + Intergenic
1016841400 6:148529142-148529164 GTACAGCAGGAGGTGAGTGGCGG - Intronic
1017519151 6:155186350-155186372 GTACAGCTGGGGCTCATTCCAGG - Intronic
1019284863 7:218407-218429 CCACACCCGAGGGTCAGTGCGGG - Intronic
1019530334 7:1499946-1499968 GAACAGCCTGGTGTCTGTGCTGG - Exonic
1023068825 7:36407156-36407178 GTACAGCTGGGATTCAATGCAGG - Intronic
1029701487 7:102249147-102249169 GTCCGGCCCGGGGTCGGTGCAGG - Exonic
1032438231 7:131920071-131920093 GTACAGCAGGAGGTGAGTGGAGG - Intergenic
1033238745 7:139659468-139659490 CTGCAGCCGGGGGTCTGTGCTGG - Intronic
1035227773 7:157443087-157443109 GTACAGCAGGAGGTGAGTGGCGG - Intergenic
1037290781 8:17347485-17347507 CTACAGCCGGGGGGTAGAGCAGG - Intronic
1037622626 8:20578183-20578205 GTACAGCCAAGGAGCAGTGCGGG + Intergenic
1037717598 8:21412998-21413020 GTTCAGACGGTGGTCAGTGAAGG + Intergenic
1039075835 8:33689759-33689781 GTTCAGCCGGGGGGCAGTCGGGG + Intergenic
1046434481 8:114169328-114169350 TTATAGCCGAGGATCAGTGCAGG + Intergenic
1057183264 9:93041017-93041039 GTCCAGCCTGGGGCCAGTACTGG - Intergenic
1060050400 9:120374549-120374571 GTCCAGCCTGGAGTCAGTGTTGG + Intergenic
1060195345 9:121620128-121620150 CTGCAGCAGGGGGTCAGAGCCGG - Intronic
1060587903 9:124797993-124798015 GTAAAGGCAGGGCTCAGTGCTGG + Intronic
1061727751 9:132590560-132590582 GAACAGGCGGGGGTCAGCGCGGG + Intergenic
1062027971 9:134349297-134349319 GGACAGCCGGGTGTCATTGGTGG + Intronic
1062166710 9:135111483-135111505 GAAAAGCAGGGGGTCAGGGCTGG - Intronic
1203543071 Un_KI270743v1:107674-107696 GGTCAGCTGGGGCTCAGTGCTGG - Intergenic
1191093141 X:56645765-56645787 GTCCTGCTGGGGGTCAGTGGGGG - Intergenic
1192667412 X:73102169-73102191 GTGCAGCCTGGGGTTAGTGGAGG + Intergenic
1196984606 X:121254250-121254272 GTACAGCCTGGGGTTAGAGGAGG + Intergenic
1197590370 X:128402351-128402373 GTACAGACGGGGGTTAGGGGAGG + Intergenic
1198050866 X:132952401-132952423 TTACAGCCAGTGGTCAGTACTGG - Intronic