ID: 968662539

View in Genome Browser
Species Human (GRCh38)
Location 4:1804748-1804770
Sequence GTACAGCCGGGGGTCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968662539_968662545 1 Left 968662539 4:1804748-1804770 CCAGCACTGACCCCCGGCTGTAC 0: 1
1: 0
2: 0
3: 11
4: 117
Right 968662545 4:1804772-1804794 TCCACGCCCTGTCGCCCACGCGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968662539 Original CRISPR GTACAGCCGGGGGTCAGTGC TGG (reversed) Intronic