ID: 968664181

View in Genome Browser
Species Human (GRCh38)
Location 4:1811667-1811689
Sequence GGGCTAGCAGGAGCGTGCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968664181_968664191 4 Left 968664181 4:1811667-1811689 CCCCAGCACGCTCCTGCTAGCCC 0: 1
1: 0
2: 0
3: 19
4: 210
Right 968664191 4:1811694-1811716 ACCCACTGTGAGCCACTGCGGGG 0: 1
1: 2
2: 1
3: 9
4: 130
968664181_968664190 3 Left 968664181 4:1811667-1811689 CCCCAGCACGCTCCTGCTAGCCC 0: 1
1: 0
2: 0
3: 19
4: 210
Right 968664190 4:1811693-1811715 GACCCACTGTGAGCCACTGCGGG 0: 1
1: 3
2: 1
3: 17
4: 189
968664181_968664195 29 Left 968664181 4:1811667-1811689 CCCCAGCACGCTCCTGCTAGCCC 0: 1
1: 0
2: 0
3: 19
4: 210
Right 968664195 4:1811719-1811741 TCCTTCATTTAAAAAAAGTCTGG 0: 1
1: 1
2: 1
3: 52
4: 521
968664181_968664189 2 Left 968664181 4:1811667-1811689 CCCCAGCACGCTCCTGCTAGCCC 0: 1
1: 0
2: 0
3: 19
4: 210
Right 968664189 4:1811692-1811714 GGACCCACTGTGAGCCACTGCGG 0: 1
1: 2
2: 1
3: 31
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968664181 Original CRISPR GGGCTAGCAGGAGCGTGCTG GGG (reversed) Exonic
900693009 1:3992982-3993004 GGGCTGGGATGAGCGTGCTGGGG + Intergenic
901392611 1:8956872-8956894 GGGCGGGAAGGAGCGTGCTGGGG + Intronic
902232518 1:15036762-15036784 GTGCTCACAGGGGCGTGCTGTGG + Intronic
903302842 1:22391339-22391361 GGGCTGGCAAGAGAGTGGTGTGG - Intergenic
904448036 1:30590302-30590324 GGGCAAGTAGGAGCTTGTTGGGG + Intergenic
905228308 1:36494291-36494313 AGGCCAGCAGGAGGGTGATGGGG - Intergenic
905508893 1:38502912-38502934 GGGCTAGCAGCAGAGAGCTTTGG - Intergenic
907270800 1:53289932-53289954 GGGGAAGCAGGAGTGTGGTGGGG - Intronic
907439885 1:54472628-54472650 GGGCCAGCAGAAGCTGGCTGTGG + Intergenic
908678339 1:66631174-66631196 AGGCTAGCAGGAGAGCACTGAGG - Intronic
911266553 1:95751388-95751410 GGGGGAGCAGGAGTGTTCTGTGG - Intergenic
912675716 1:111679237-111679259 GGGCTAGCAGAAGCAGGGTGGGG + Intronic
914950733 1:152111155-152111177 GCGCGAGCAGGAGCTAGCTGAGG - Exonic
915091671 1:153430409-153430431 TGGCCAGCAGGAGTGTGCTCTGG - Intergenic
915555058 1:156656764-156656786 GGGGTAGCAGGAGCCTGGAGGGG - Intronic
915627205 1:157122211-157122233 GTGCTACCAGGAGTGGGCTGAGG + Exonic
916529942 1:165647427-165647449 GGGCTAGCTGGAGTGTTTTGGGG + Intronic
1063688217 10:8258606-8258628 AGGCTAGCAGGAAAGTGCTGTGG - Intergenic
1064353264 10:14596114-14596136 TGGCTGGCAGGAGCTTGCTATGG - Intronic
1068658714 10:59601535-59601557 AGGCTAGCATGAACCTGCTGAGG - Intergenic
1069703110 10:70440633-70440655 CGGCGAGCAGGTGGGTGCTGCGG - Intronic
1070279102 10:75036009-75036031 GGGGTAGCAGGATCCTGATGGGG + Intergenic
1073116475 10:101094464-101094486 GGGCCAGCTGGAGCTGGCTGAGG + Intronic
1073479801 10:103779369-103779391 GGGGTATCAGGAGGATGCTGGGG - Intronic
1075054433 10:119207269-119207291 GGGCAAGCGGGAGCCTGCGGGGG + Intergenic
1075614757 10:123883032-123883054 GGGCTGGCAGGGCCGTGGTGTGG - Intronic
1075747589 10:124738459-124738481 GAGTTTGTAGGAGCGTGCTGGGG - Intronic
1076066573 10:127453032-127453054 GGCCTAGAAGGAGGCTGCTGTGG + Intergenic
1076266935 10:129116127-129116149 GGGCAAGGAGGAGCGTGTTCTGG + Intergenic
1077059351 11:610968-610990 GCACATGCAGGAGCGTGCTGTGG + Exonic
1077179819 11:1207256-1207278 GGGCTGGCAGGAGGGTGCCAGGG + Intergenic
1077185817 11:1234890-1234912 GTGCTACCAGGAGCCTGGTGGGG + Intronic
1077522258 11:3043363-3043385 GGGCAGGCAGGAGCCGGCTGAGG - Intronic
1079025697 11:16946099-16946121 GGGGCAGCAGGAGCCTGCTGTGG + Intronic
1080641824 11:34162793-34162815 GGGCCTGCAGGAACGTCCTGAGG - Exonic
1080740978 11:35064109-35064131 GGACTAGCATGAGCAGGCTGAGG - Intergenic
1083316325 11:61816794-61816816 GGGCTGTCAGGCGCGTGCTCGGG + Exonic
1084496941 11:69510685-69510707 GGGCTAGCAAGGGCTTGTTGGGG - Intergenic
1084651138 11:70490142-70490164 GGGCTGGCAGGGCCTTGCTGGGG + Intronic
1088907743 11:114167645-114167667 GGGAGAGCAGGAGGGGGCTGGGG - Intronic
1091261187 11:134235533-134235555 CAGCCAGCAGGAGTGTGCTGGGG - Intronic
1091267755 11:134283731-134283753 GGTCTTGCAGGAGCCAGCTGGGG - Exonic
1091329430 11:134719593-134719615 GGGCTCGCAGGAGGGTGGGGAGG - Intergenic
1095831543 12:46591962-46591984 GGGCTAGCAGAAGCAGGGTGGGG - Intergenic
1102463679 12:113115569-113115591 GGGCTTGCAGGAGGGTCCTGGGG - Intronic
1102959909 12:117085608-117085630 TGGCAAGCAGGAGAGAGCTGGGG - Intronic
1103740591 12:123088539-123088561 GGGGTGGCAGGAGGGTGGTGTGG + Intronic
1104766330 12:131332768-131332790 GGCCTGGCAGGAGCGTGGCGTGG + Intergenic
1104813077 12:131629829-131629851 GGCCTGGCAGGAGCGTGGCGTGG - Intergenic
1104947670 12:132423810-132423832 GGGCCAGCAAGCGGGTGCTGTGG + Intergenic
1105422621 13:20266435-20266457 CGGCCAGGAGGAGTGTGCTGTGG + Intergenic
1109191909 13:59334851-59334873 GGGCTAGCAGGAGGGAGATGGGG + Intergenic
1113423151 13:110185707-110185729 GGGCCAGCGGGAGGGGGCTGTGG - Intronic
1119662900 14:76464296-76464318 GGGGTAGCAGGAGTGCCCTGGGG - Intronic
1119859394 14:77925382-77925404 GGGCTTGGAGGAGCCTGCAGGGG + Intronic
1120297739 14:82664999-82665021 GGATTAGTAGGAGTGTGCTGGGG + Intergenic
1122481277 14:102049076-102049098 GGGCAAACAGGAGGATGCTGGGG - Intronic
1122770852 14:104097060-104097082 GGGCTGGAAGGAGGGTGGTGGGG - Intronic
1122771178 14:104098629-104098651 GGGCTAACCGGAGCCTGCAGGGG - Intronic
1128456789 15:67835643-67835665 CGGCTAGTAGGGGCGTGCTCTGG + Intergenic
1130097611 15:80867648-80867670 GGGCTGGCAGGAGGGAGCTCAGG + Intronic
1131412491 15:92221391-92221413 GGGCTATCAGCAGCCTGCAGAGG + Intergenic
1133294327 16:4743523-4743545 GGGGAAGCGGGAGCGTGCTTAGG - Intronic
1134789915 16:16980573-16980595 GGGCTAGCAGGCGGGTTCTGGGG - Intergenic
1134802506 16:17098637-17098659 TGGCTAGCACGAGCATTCTGTGG + Intergenic
1135133587 16:19871948-19871970 GGGCTGGCAGAAGGGTGCAGTGG + Exonic
1139656329 16:68389268-68389290 AGGCAGGCAGGAGCGTGCTTGGG - Intronic
1141461349 16:84180257-84180279 GGGCCAGCAGGAGCGGGGAGGGG + Exonic
1142675716 17:1511994-1512016 GGACTAGCAGGAGGTGGCTGGGG + Intronic
1144702825 17:17349935-17349957 GGGCTGGGGGGAGCTTGCTGAGG + Intergenic
1148793188 17:50184986-50185008 GGGCGGGCAGGAGCGGGCTGAGG + Exonic
1151479654 17:74362482-74362504 GGGCTGGCAGGAAAGTTCTGTGG + Intergenic
1152511792 17:80794925-80794947 GGGCTAGCGGGAGGGGCCTGGGG + Intronic
1152691496 17:81720193-81720215 GGGACAGCAGGGGCCTGCTGCGG - Exonic
1152925911 17:83087670-83087692 GCGCTGGCCGGAGAGTGCTGGGG - Intronic
1153815039 18:8784285-8784307 GGGCAAGAAGGAGAGTGATGGGG + Exonic
1157198242 18:45637729-45637751 GGCCTGGGAGCAGCGTGCTGGGG - Intronic
1159943206 18:74424887-74424909 GTGCAAGCAGCAGCGTGCGGAGG + Intergenic
1160665389 19:325760-325782 AGGCTGGCTGCAGCGTGCTGTGG + Intronic
1161119692 19:2518498-2518520 CGGCCAGCAGCAGCGTGATGGGG + Intronic
1161612376 19:5250550-5250572 GAGCCAGCTGGAGCGTGCTGAGG - Intronic
1161977348 19:7613773-7613795 GGGGTGGTAGGAGCGTGCTGGGG - Intronic
1162739019 19:12763404-12763426 GGCCTTGCAGCAGCGAGCTGGGG - Exonic
1162781524 19:13009432-13009454 GGGCTAGAAGCAGGGTGGTGGGG + Intronic
1163752016 19:19083789-19083811 GGGCCAGGAGGTGCATGCTGGGG - Intronic
1164911141 19:32012908-32012930 GGGCTAGCAGGAGCCAGAAGAGG + Intergenic
1165770024 19:38374651-38374673 GGGCTACCCGGGGCGGGCTGAGG + Exonic
1166745981 19:45142087-45142109 GGTCCAGCAGGGGCGTGTTGCGG - Exonic
1167604188 19:50472392-50472414 GGGCTAGGAGGTGAGTCCTGAGG + Intronic
1167711451 19:51113957-51113979 GGGCCATTAGGAGGGTGCTGGGG - Intergenic
925627944 2:5860862-5860884 GGGCAAGCAGGAGCAGGGTGGGG - Intergenic
926061221 2:9806349-9806371 GGGCCAGCAGGCGTGTGATGTGG - Intergenic
926101386 2:10120567-10120589 GGGCTAGCAGCAGCCTGCGGCGG + Intergenic
927260471 2:21083501-21083523 GGGGAAGCAGAAGAGTGCTGGGG + Intergenic
930376203 2:50570239-50570261 GGGCTGGCAGCAGAGTACTGGGG + Intronic
931177744 2:59870641-59870663 GGGTAAGGAGGAGGGTGCTGAGG - Intergenic
931714853 2:65020999-65021021 AGGCGAGCAGGAACTTGCTGAGG + Exonic
932239412 2:70145163-70145185 GGGATAGGAGGAGCTGGCTGAGG + Intergenic
932401010 2:71481304-71481326 GGGCTAGCAGGAGCCAGAGGAGG - Intronic
932480778 2:72037676-72037698 GGGCTGGGAGCAGCGTCCTGGGG - Intergenic
933810946 2:86032361-86032383 GGGAGAGCAGGAGGGTGATGAGG - Exonic
941054981 2:160777117-160777139 GTGCCAGCAGCAGGGTGCTGCGG - Intergenic
941115094 2:161462692-161462714 GGGCTAGCAGAAGCGGGGTGGGG - Intronic
941964508 2:171287590-171287612 GGGAAAGCAGAAGTGTGCTGAGG - Intergenic
942143491 2:173001740-173001762 GGGGGAGCAGGAGCGAGGTGGGG + Intronic
942184939 2:173416033-173416055 GGGCTAACAGGAGGGGGCTGCGG + Intergenic
948378163 2:237536060-237536082 GTGCTACAAGGAGCGTCCTGCGG - Intronic
1171489252 20:25504926-25504948 GAGCGAGCAGGAGCTGGCTGTGG - Exonic
1172015534 20:31870556-31870578 GGGGTAGGAGGAGCCTGCGGCGG - Exonic
1172930427 20:38582532-38582554 GGGCTAGCAGGGGTGTGGGGAGG - Intronic
1173911622 20:46674935-46674957 GGGCTGGGATGAGGGTGCTGTGG + Intronic
1175776341 20:61656215-61656237 AGGCGGGCAGGCGCGTGCTGGGG + Intronic
1175776347 20:61656235-61656257 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776353 20:61656255-61656277 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776359 20:61656275-61656297 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1179590697 21:42406011-42406033 GGGATTGCAGGAGCGGGCGGAGG + Intronic
1179821203 21:43938250-43938272 GGGATAGAAGGAACGTACTGAGG + Intronic
1181235066 22:21443715-21443737 GGCTCAGCAGGAGGGTGCTGGGG - Intronic
1182021605 22:27086310-27086332 GGGCTAGGAGTAGAGAGCTGTGG - Intergenic
1183281264 22:36933861-36933883 GGGCTGGCAGGGCCATGCTGTGG - Exonic
1183581466 22:38729001-38729023 GGGGCAGCAGCAGCGTGCTGGGG + Intronic
1184644063 22:45886566-45886588 GGGCGGGAAGGAGGGTGCTGGGG - Intergenic
1184652219 22:45924666-45924688 AGGCTGGCAGGTGGGTGCTGGGG + Intronic
1184669865 22:46006963-46006985 AGGCTGGCAGGACCCTGCTGTGG - Intergenic
1185182650 22:49372174-49372196 GGGCTGGCAGATGGGTGCTGTGG + Intergenic
950216421 3:11162998-11163020 GTGCTAGCTGGAGCATGCTTAGG + Intronic
957054794 3:75435227-75435249 GGGTCAGGAGGAGCGTCCTGGGG + Intergenic
957993336 3:87654167-87654189 GGGCAAGCAGAAGCATGGTGGGG - Intergenic
960743440 3:120859816-120859838 AGGGTTGCAGGAGCGTGTTGAGG + Intergenic
961168616 3:124780294-124780316 GGGCTAGCAGGACCGCAGTGGGG + Intronic
961387118 3:126528969-126528991 CTGCTGGCAGGAGCTTGCTGGGG + Intronic
961888445 3:130111589-130111611 GGGTCAGGAGGAGCGTCCTGGGG + Intronic
965091159 3:164163725-164163747 GGGCTAGCAGAAGCAGGGTGGGG - Intergenic
965988870 3:174791201-174791223 GGGCAAACAGGACCATGCTGTGG + Intronic
966291110 3:178360958-178360980 GGGCAAGCAGAAGCATGGTGGGG + Intergenic
966525351 3:180913157-180913179 GGGGTCGGAGGAGCGGGCTGAGG - Intronic
966809168 3:183828062-183828084 GGGCAATCAGGAGGGAGCTGTGG + Intergenic
966831912 3:184017478-184017500 GGGCAGGCCGGAGCGGGCTGTGG - Intronic
966914784 3:184578637-184578659 GGGCTAGCAGGAGTGAGTAGGGG - Intronic
968432740 4:568326-568348 GGGACAGCAGGAAGGTGCTGAGG - Intergenic
968655700 4:1777649-1777671 GGGCTGGGAGGAGCCTCCTGGGG - Intergenic
968664181 4:1811667-1811689 GGGCTAGCAGGAGCGTGCTGGGG - Exonic
968740847 4:2331032-2331054 GGGCTGGAAGGAGGGGGCTGGGG + Intronic
968740865 4:2331081-2331103 GGGCTGGAAGGAGGGGGCTGGGG + Intronic
969436574 4:7192564-7192586 GGGAGAGCAGGAGGGCGCTGGGG - Exonic
970714645 4:18907609-18907631 GGGCTAGCAGAAGCAGGGTGGGG + Intergenic
972671042 4:41214343-41214365 GGGGCAGCACGAGAGTGCTGGGG - Intronic
976145105 4:82034641-82034663 GGGCATGCAGGAGCCTGCTGGGG - Intronic
978384457 4:108166895-108166917 GGGCTAGCAGCTGGGAGCTGTGG - Intronic
978640557 4:110866273-110866295 GGGCTAGCACTAGCGAACTGGGG - Intergenic
979023155 4:115528609-115528631 GGTCTTGAAGGAGAGTGCTGCGG - Intergenic
985586000 5:734674-734696 GGGCTACCAGGCTGGTGCTGGGG - Intronic
985600419 5:826086-826108 GGGCTACCAGGCTGGTGCTGGGG - Intronic
988289724 5:29270188-29270210 GGGCTAGCAGAAGCAAGGTGGGG + Intergenic
988504226 5:31807792-31807814 GGGCTGGCAGGAGGGGGCTGGGG + Intronic
988811892 5:34793484-34793506 GTGCTAGCAGGAGGGTTTTGGGG + Intronic
991110819 5:62897126-62897148 GGGCTAGCAGAAGCATGGTGAGG - Intergenic
993952518 5:94194185-94194207 GGGTTAGCAGGAGCCTGGGGAGG - Intronic
995301835 5:110594153-110594175 GGGCAAGCAGAAGCATGGTGGGG + Intronic
997613042 5:135228552-135228574 GAGCTAGCAGGAGCTGGCTTTGG + Intronic
997677216 5:135721775-135721797 GGGCTGTCAGCAGCCTGCTGTGG - Intergenic
998266729 5:140672577-140672599 GCGCGAGCAGCAGCGCGCTGCGG + Exonic
998303187 5:141046375-141046397 GGGCTAGCAGGAACTTTGTGTGG + Intergenic
998488823 5:142528116-142528138 GGGCCAGCAGGAACTTTCTGGGG - Intergenic
998984330 5:147739121-147739143 GGGCTTGAATGAGCCTGCTGGGG + Intronic
999772450 5:154785835-154785857 GGGGTAGAAGGTGGGTGCTGAGG - Intronic
1000547979 5:162625558-162625580 GGGCTAGCAGAAGCAGGGTGGGG + Intergenic
1002180904 5:177430719-177430741 GGGCGTGCTGGAGCGTGCAGAGG + Intronic
1003212238 6:4078799-4078821 GGGGTAGCAGGAGGGGGCTGCGG + Intronic
1007735581 6:43980367-43980389 GGGCATGCAGGAGGGGGCTGGGG - Intergenic
1010606327 6:77892977-77892999 GGGATTGCAGGAGCCTGCAGTGG + Intronic
1011120007 6:83942321-83942343 GGGCGAGCAGAAGCATGGTGGGG + Intronic
1011189175 6:84712617-84712639 GGGCTAGCAGGCCCGTCCAGGGG + Intronic
1013944378 6:115704404-115704426 GGCCTAGCAGGGGCGTCCAGGGG + Intergenic
1014177109 6:118342836-118342858 GGGCAAGCAGAAGCATGGTGGGG - Intergenic
1017017362 6:150112570-150112592 GGGCAAGCAGGTGCTGGCTGTGG - Intergenic
1019164048 6:170087418-170087440 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164065 6:170087458-170087480 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164082 6:170087498-170087520 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164098 6:170087538-170087560 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164146 6:170087660-170087682 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164181 6:170087742-170087764 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164224 6:170087843-170087865 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164242 6:170087884-170087906 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164260 6:170087925-170087947 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019502228 7:1370006-1370028 GGGATTGCAGGCACGTGCTGTGG + Intergenic
1019650048 7:2152029-2152051 AGGCAAGGAGGAGCGTGCAGGGG - Intronic
1020201142 7:6081289-6081311 GGGCCAGGAGGAGGGTGTTGGGG - Intergenic
1023402015 7:39797558-39797580 GGGCTAGCAGGAGTGTACAAGGG - Intergenic
1024075994 7:45818188-45818210 GGGCTAGCAGGAGTGTACAAGGG - Intergenic
1024647606 7:51383101-51383123 GGGCTAGCAGGAGTGTACAACGG + Intergenic
1025051441 7:55737596-55737618 GGGCTAGCAGGAGTGTACAAGGG + Intergenic
1026776023 7:73231609-73231631 GTGCCAGCAGGAGCTTGCCGAGG + Intergenic
1027016880 7:74784980-74785002 GTGCCAGCAGGAGCTTGCCGAGG + Intronic
1027071147 7:75160956-75160978 GTGCCAGCAGGAGCTTGCCGAGG - Intergenic
1027211266 7:76150536-76150558 GGCCTGGCAGGAGCGGGCCGGGG - Intergenic
1029986421 7:104927262-104927284 GGTAGAGCAGGAGCGGGCTGTGG + Intergenic
1030727223 7:112939816-112939838 GGGGTAGGAGGAGGGAGCTGCGG + Exonic
1031717377 7:125125513-125125535 GGGCGAGCAGAAGCAGGCTGGGG - Intergenic
1032335186 7:131018436-131018458 GGGGCAGCGGGAGTGTGCTGGGG - Intergenic
1035096728 7:156361890-156361912 GGGTGAGCAGGGGCGAGCTGAGG - Intergenic
1035417469 7:158702463-158702485 GGGGTGGGAGGAGGGTGCTGTGG - Intronic
1036379654 8:8228466-8228488 GGGTCAGGAGGAGCGTCCTGGGG - Intergenic
1038447193 8:27612228-27612250 GGGTTACCATGAGCATGCTGTGG - Intronic
1041919656 8:63168165-63168187 GGCCTAGCAGGAGCCTTCGGCGG - Intergenic
1047252066 8:123188160-123188182 GAGCTACCAGAAGCGTGCAGTGG - Intronic
1047767578 8:128002013-128002035 GGTCGAGCAGGATTGTGCTGGGG - Intergenic
1048692538 8:136983800-136983822 GGGCTAAGAGGAGTGTGATGAGG - Intergenic
1049743386 8:144251796-144251818 GGGCACACAGGAGCCTGCTGGGG - Intronic
1049825409 8:144664452-144664474 GGGCTAGCAGCCAGGTGCTGAGG - Intergenic
1050031682 9:1393252-1393274 GGGCTAGCAGAAGCAGGGTGGGG + Intergenic
1051663345 9:19445624-19445646 GGTCTTGCAGGAGCATGCTTGGG + Intronic
1057177439 9:93010400-93010422 GGGCTCCCAGGAGGGTGCAGGGG + Intronic
1057453919 9:95190571-95190593 GGGCAAGCAAGAGGGTGCAGGGG - Intronic
1058392602 9:104512782-104512804 AGGCTAGCAGGAGCTTACAGGGG + Intergenic
1058890579 9:109357325-109357347 CAGCCAGCAGGAGCTTGCTGTGG - Intergenic
1059441943 9:114312758-114312780 GGGCTACCAGGAGCGGGAAGAGG - Intergenic
1059492036 9:114675989-114676011 GGGCCAGCAGGGGAGTGCTGTGG - Intergenic
1060597779 9:124858466-124858488 TGGTTAGCAAGAGCATGCTGGGG + Intronic
1060960731 9:127678888-127678910 GGGCAGGCAGGGCCGTGCTGGGG - Intronic
1061870386 9:133517208-133517230 TGGCAGGAAGGAGCGTGCTGGGG - Intronic
1062613443 9:137385412-137385434 GGGCTGGGCGGGGCGTGCTGTGG + Intronic
1186616001 X:11188719-11188741 GGGCTAGGAGGAGGGTGAGGTGG - Exonic
1187369607 X:18693939-18693961 GGGCTAGCAGGAGGGAGTTTTGG - Intronic
1191684065 X:63870823-63870845 GGGCCAGAAGGAGGTTGCTGGGG + Intergenic
1194954497 X:100162854-100162876 GGGCAAGCAGAAGCGGGGTGGGG - Intergenic
1196124613 X:112084212-112084234 AGGCTAGGAGGAGAGTGCTTAGG - Intergenic
1197305877 X:124841577-124841599 TGGCTAGCAGGTGAGTGTTGTGG + Intronic
1199786950 X:151114390-151114412 GTGCCAGCAGCAGCGTGGTGGGG + Intergenic
1199861302 X:151802231-151802253 GGGCCACCAAGAGCCTGCTGAGG - Intergenic