ID: 968664493

View in Genome Browser
Species Human (GRCh38)
Location 4:1813652-1813674
Sequence GGGGCTCTGAAGCGCATTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968664493_968664496 -5 Left 968664493 4:1813652-1813674 CCCCAAATGCGCTTCAGAGCCCC 0: 1
1: 1
2: 0
3: 7
4: 103
Right 968664496 4:1813670-1813692 GCCCCACCAACCCCCAAGCCAGG 0: 1
1: 0
2: 5
3: 55
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968664493 Original CRISPR GGGGCTCTGAAGCGCATTTG GGG (reversed) Exonic
900220965 1:1509134-1509156 GGGGCCCTGGCGTGCATTTGGGG + Intergenic
900225970 1:1533855-1533877 GGGGCCCTGGCGTGCATTTGGGG + Intronic
900364568 1:2305833-2305855 GGGGGTCTGAAAAGCCTTTGTGG + Intronic
901128304 1:6944665-6944687 GGGGCTCTGAAATGCATGGGAGG - Intronic
901330814 1:8406913-8406935 CGGGCTCTGTAGCACATTTGTGG - Intronic
903704013 1:25271760-25271782 GGGGCACTACAGTGCATTTGAGG - Intronic
910900457 1:92114985-92115007 GGGGCCCTCAAGGGCATCTGGGG - Intronic
913218835 1:116643395-116643417 GGGCCTCTGAAGGTCACTTGAGG - Intronic
915168850 1:153963758-153963780 GGGGCCCTGGGGCGCATCTGTGG + Intronic
916249793 1:162725753-162725775 GGGTCTCTGTAGCCCATTCGTGG - Intronic
918017956 1:180656094-180656116 GGGGCTCAGAAGGGTATTGGGGG - Intronic
921930643 1:220751697-220751719 GGGGCTCTATAGCTCTTTTGGGG + Intronic
1062902539 10:1156893-1156915 GGGTCTGTGATGCGCATCTGAGG + Intergenic
1063524668 10:6773632-6773654 GGGACTCTGGAGGGCTTTTGAGG - Intergenic
1064643688 10:17438997-17439019 GAGGCTGTGAAGCACATTTTGGG - Intronic
1064981554 10:21172062-21172084 TGGGCTCTGAAGTGCATGTCAGG - Intronic
1065156402 10:22874310-22874332 AGGCCTCTGAAGCGCAGCTGAGG + Intergenic
1067922711 10:50476581-50476603 AGGTCTCTGAAGTGCATTGGAGG - Intronic
1070517450 10:77221362-77221384 GGGTCCCTGAAGCGCATCTATGG - Intronic
1070725089 10:78782197-78782219 GGGGCTGTGAAGCGTGATTGAGG - Intergenic
1073082173 10:100867160-100867182 GGTGCTCTGAAGCAGAGTTGGGG - Intergenic
1074285709 10:112096238-112096260 GGGGCTGTGAATTGAATTTGGGG - Intergenic
1075488663 10:122847834-122847856 AGGGCTCTAAAGCCCATGTGCGG + Intronic
1078101584 11:8333397-8333419 GGGGCTCTGATCCCTATTTGAGG + Intergenic
1079078355 11:17397234-17397256 GGGGCTGTGAAGCGCATCCATGG - Exonic
1079803141 11:24896308-24896330 GGGGCTGTGCAGGGCAATTGCGG + Intronic
1081452731 11:43187577-43187599 TGGGCTCTAAATGGCATTTGAGG - Intergenic
1081601808 11:44500572-44500594 GGGACTCGGAAGAGGATTTGGGG - Intergenic
1083416822 11:62531223-62531245 GGAGCTCTGAAGTGCATCTCAGG + Exonic
1083672295 11:64306094-64306116 GGGGCTCTGAAGACCACGTGGGG + Intronic
1085175797 11:74487139-74487161 TGGGCTCTGAAGGGCAAGTGAGG - Intergenic
1096541945 12:52313005-52313027 AGGGCTCTGAAGCCCAGGTGGGG + Intergenic
1100394610 12:94173903-94173925 GGGTCTCTGAATCTCCTTTGGGG + Intronic
1105344715 13:19561609-19561631 GGGGCTCTGAAGACCACGTGGGG - Intergenic
1105535322 13:21259958-21259980 GGGGCTCTGAAGACCACGTGGGG + Intergenic
1106383786 13:29264863-29264885 AGGTCTCTGAAATGCATTTGAGG + Intronic
1119482072 14:74964157-74964179 GGGGCTCTGACGCAGACTTGTGG + Intergenic
1119874274 14:78043885-78043907 GGGGCTCTGACTTACATTTGGGG + Intergenic
1122159689 14:99774085-99774107 GGGCCTCTGAACCACACTTGGGG + Intronic
1122252652 14:100450881-100450903 GGGACTGTGAAGTGCTTTTGGGG - Intronic
1122634764 14:103124699-103124721 GGGGCTGGGAAGCGAAGTTGGGG + Intronic
1123937167 15:25199616-25199638 GAGGCCCTGAAGGGCATCTGGGG + Intergenic
1125285615 15:38089388-38089410 TGGGCTCTAAAGAGTATTTGTGG - Intergenic
1128760125 15:70210821-70210843 GGGGCTCTGAAGCACCTTTAGGG - Intergenic
1130105715 15:80927208-80927230 GGGTTTCTGAAGGGCATTTAGGG + Intronic
1131050993 15:89347773-89347795 GAGGCTCTGAGGATCATTTGGGG - Intergenic
1137674036 16:50295002-50295024 GGGGCTCTGGAGCTCAGATGGGG + Intronic
1137811765 16:51359352-51359374 GGGGCTCTGAAGCTGAATTGTGG + Intergenic
1140887575 16:79258557-79258579 AGGTCTCTGATGGGCATTTGTGG + Intergenic
1143195207 17:5071089-5071111 GGGGCTCTAAGGCACATTTGGGG + Intergenic
1148797469 17:50203899-50203921 GGGGTTCTGAAGGATATTTGGGG + Intergenic
1151563368 17:74882928-74882950 GAGGCTCTGCAAAGCATTTGGGG + Intronic
1160006137 18:75070369-75070391 GGGGCTCTGTGGCGCAGTGGAGG - Intergenic
1161612498 19:5250961-5250983 GGGGCTCTGCTGGGCATTTTGGG + Intronic
1162782757 19:13015042-13015064 GTGGCTGTGAAGTGCCTTTGAGG + Intronic
1166975202 19:46601664-46601686 GGGGCTCAGATACCCATTTGTGG - Intronic
1167611826 19:50511393-50511415 GGGCCTCTGAGGCGCACTTCCGG - Intergenic
1168643898 19:58047614-58047636 GGGGCTCTGAAGCACATTTGGGG + Intronic
926775058 2:16413773-16413795 GGGGGTCAGAAGAGGATTTGAGG + Intergenic
928089608 2:28366153-28366175 GGGACTCTGAAGAGCAGTTCTGG - Intergenic
932060852 2:68496035-68496057 AGGTCTCTGAAATGCATTTGAGG + Intronic
940717672 2:157246207-157246229 GGTGCTATGTAGGGCATTTGAGG - Intergenic
943557776 2:189427059-189427081 GGGTCTCTGAAATGCCTTTGAGG - Intergenic
945534011 2:210989551-210989573 AGGTCTCTGAAATGCATTTGAGG - Intergenic
1168853566 20:993201-993223 GGGGCTCTGATGTGCCATTGCGG - Intronic
1169132342 20:3172828-3172850 GGGGCACTGCAGGGCTTTTGGGG + Intronic
1169220441 20:3819464-3819486 GAGGCTCCGAGGCACATTTGGGG + Intergenic
1170557014 20:17522928-17522950 GGGGCTCTGCAGCTCACCTGCGG + Intronic
1174366688 20:50060848-50060870 GGGGCTGTGAAGAGCTGTTGAGG + Intergenic
1179412258 21:41170916-41170938 GGGGGTCTTATACGCATTTGGGG + Intronic
1179933671 21:44589833-44589855 GGGGCTCAGACACGCATGTGTGG + Intronic
1180820136 22:18821457-18821479 GGGCCTCTGAAGGTCACTTGAGG - Intergenic
1181206359 22:21255929-21255951 GGGCCTCTGAAGGTCACTTGAGG - Intergenic
1183094842 22:35545856-35545878 TGGGCTGTGAAGAGCCTTTGGGG + Intronic
1184285131 22:43466270-43466292 GGGGGTCTGCAGCTCATTGGGGG + Intronic
1203220561 22_KI270731v1_random:39494-39516 GGGCCTCTGAAGGTCACTTGAGG + Intergenic
1203270263 22_KI270734v1_random:47328-47350 GGGCCTCTGAAGGTCACTTGAGG - Intergenic
949987652 3:9553131-9553153 GGAGCTCAGAAGGGAATTTGGGG + Intronic
958186158 3:90121933-90121955 GGGGCTCTGAAGAGGATCTCTGG + Intergenic
958724926 3:97893441-97893463 CGGGCTCTGAACTGCTTTTGAGG + Intronic
960613822 3:119579546-119579568 CGGGCTCTTCAGAGCATTTGGGG + Exonic
960928513 3:122820740-122820762 GGGACTCTGCAGCGCACCTGGGG + Intronic
962715276 3:138120348-138120370 GGGGCTGTGAAGAGATTTTGGGG - Intergenic
963328658 3:143890109-143890131 GGGTCTCTGAATGGCATGTGAGG + Intergenic
964892640 3:161555406-161555428 GTGGCTTTGAATGGCATTTGTGG - Intergenic
965129434 3:164676959-164676981 AGGGCCCTGAAGCACATTTTAGG + Intergenic
968664493 4:1813652-1813674 GGGGCTCTGAAGCGCATTTGGGG - Exonic
970909075 4:21253250-21253272 GGGTCTCTGAGGCTCATTTTTGG + Intronic
971256349 4:25017219-25017241 GGGACTCTGAAAGTCATTTGTGG + Intronic
971545510 4:27880308-27880330 AGGTCTCTGAAATGCATTTGAGG + Intergenic
979965916 4:127076808-127076830 GGGGCTCAGGAACCCATTTGAGG + Intergenic
986035194 5:3930342-3930364 GGGGCTCTGAAGGGTGTCTGAGG + Intergenic
992565349 5:77990521-77990543 GGGGCTCAGAATGGCATTTTGGG + Intergenic
997694982 5:135853766-135853788 GATGCTCTTAAGAGCATTTGGGG - Intronic
998153648 5:139771779-139771801 GGGGCAGTGTAGCGCATATGGGG + Intergenic
1004190438 6:13458792-13458814 AGGGGGCTGAAGAGCATTTGGGG + Intronic
1004241067 6:13923274-13923296 GGGGCTCAGAACCGTATGTGTGG - Intergenic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1006595769 6:35191835-35191857 GGTGGTCTGCAGCACATTTGGGG - Intergenic
1015264827 6:131280381-131280403 GGGGCTCTGAAGCAAGGTTGGGG + Intronic
1016349909 6:143155801-143155823 GGGACTGGGAAGAGCATTTGGGG + Intronic
1017694710 6:157003096-157003118 GGGGCTTTGAAGCTCCTGTGAGG + Intronic
1018030004 6:159834275-159834297 AGGGATCTGAAGCACCTTTGGGG - Intergenic
1019351050 7:554115-554137 TGGGCTCTGAGGCCCATGTGGGG + Intronic
1034789048 7:153951207-153951229 GGGGCTGAGAAGCGCATTGGAGG + Intronic
1039474811 8:37834069-37834091 GGTGCCCTGGAGCGCATTGGGGG + Exonic
1044929159 8:97235163-97235185 GGGGCTCTGAAGCCCCCTGGAGG - Intergenic
1047724123 8:127669665-127669687 GGGGCTCTGAAGAGAAATTGAGG - Intergenic
1048345304 8:133571212-133571234 GGCGCTCTCGAGCGGATTTGGGG - Intronic
1048536810 8:135304009-135304031 GGGGCTTAGAAGGGCATTTGAGG - Intergenic
1197510259 X:127361981-127362003 AGGTCTCTGAAGTGCCTTTGAGG + Intergenic
1199109186 X:143910100-143910122 GGGTCTCTGAAATGCCTTTGAGG + Intergenic