ID: 968664835

View in Genome Browser
Species Human (GRCh38)
Location 4:1815353-1815375
Sequence GGTGCAGCAAACACCTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968664835_968664844 5 Left 968664835 4:1815353-1815375 CCCTGAGAGGTGTTTGCTGCACC No data
Right 968664844 4:1815381-1815403 GGCTCCCCAGTGCCACCAGCTGG 0: 1
1: 0
2: 6
3: 36
4: 313
968664835_968664852 12 Left 968664835 4:1815353-1815375 CCCTGAGAGGTGTTTGCTGCACC No data
Right 968664852 4:1815388-1815410 CAGTGCCACCAGCTGGGGGCGGG 0: 1
1: 0
2: 3
3: 41
4: 418
968664835_968664857 20 Left 968664835 4:1815353-1815375 CCCTGAGAGGTGTTTGCTGCACC No data
Right 968664857 4:1815396-1815418 CCAGCTGGGGGCGGGGTCCAGGG 0: 1
1: 0
2: 0
3: 44
4: 352
968664835_968664846 7 Left 968664835 4:1815353-1815375 CCCTGAGAGGTGTTTGCTGCACC No data
Right 968664846 4:1815383-1815405 CTCCCCAGTGCCACCAGCTGGGG No data
968664835_968664853 13 Left 968664835 4:1815353-1815375 CCCTGAGAGGTGTTTGCTGCACC No data
Right 968664853 4:1815389-1815411 AGTGCCACCAGCTGGGGGCGGGG 0: 1
1: 0
2: 0
3: 28
4: 309
968664835_968664855 19 Left 968664835 4:1815353-1815375 CCCTGAGAGGTGTTTGCTGCACC No data
Right 968664855 4:1815395-1815417 ACCAGCTGGGGGCGGGGTCCAGG 0: 1
1: 0
2: 1
3: 26
4: 379
968664835_968664845 6 Left 968664835 4:1815353-1815375 CCCTGAGAGGTGTTTGCTGCACC No data
Right 968664845 4:1815382-1815404 GCTCCCCAGTGCCACCAGCTGGG 0: 1
1: 0
2: 3
3: 25
4: 287
968664835_968664851 11 Left 968664835 4:1815353-1815375 CCCTGAGAGGTGTTTGCTGCACC No data
Right 968664851 4:1815387-1815409 CCAGTGCCACCAGCTGGGGGCGG No data
968664835_968664847 8 Left 968664835 4:1815353-1815375 CCCTGAGAGGTGTTTGCTGCACC No data
Right 968664847 4:1815384-1815406 TCCCCAGTGCCACCAGCTGGGGG 0: 1
1: 0
2: 0
3: 21
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968664835 Original CRISPR GGTGCAGCAAACACCTCTCA GGG (reversed) Intronic