ID: 968668545

View in Genome Browser
Species Human (GRCh38)
Location 4:1834910-1834932
Sequence TCTCCTCGATGGTGTCCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 2, 1: 1, 2: 0, 3: 12, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968668541_968668545 -5 Left 968668541 4:1834892-1834914 CCTTGTTCTTCAAGGCCATCTCC 0: 1
1: 1
2: 0
3: 24
4: 255
Right 968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG 0: 2
1: 1
2: 0
3: 12
4: 136
968668539_968668545 4 Left 968668539 4:1834883-1834905 CCTTGGCTGCCTTGTTCTTCAAG 0: 1
1: 1
2: 1
3: 31
4: 260
Right 968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG 0: 2
1: 1
2: 0
3: 12
4: 136
968668538_968668545 5 Left 968668538 4:1834882-1834904 CCCTTGGCTGCCTTGTTCTTCAA 0: 1
1: 1
2: 4
3: 35
4: 322
Right 968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG 0: 2
1: 1
2: 0
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968668545 Original CRISPR TCTCCTCGATGGTGTCCTGG AGG Exonic