ID: 968669355

View in Genome Browser
Species Human (GRCh38)
Location 4:1840541-1840563
Sequence TCCCGAGTAGCTGGCACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 705216
Summary {0: 270, 1: 57609, 2: 183624, 3: 273771, 4: 189942}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968669355_968669367 15 Left 968669355 4:1840541-1840563 CCTGTAGTGCCAGCTACTCGGGA 0: 270
1: 57609
2: 183624
3: 273771
4: 189942
Right 968669367 4:1840579-1840601 ATGGTGTGGACCCCGGGGGGCGG 0: 1
1: 14
2: 220
3: 562
4: 592
968669355_968669360 -4 Left 968669355 4:1840541-1840563 CCTGTAGTGCCAGCTACTCGGGA 0: 270
1: 57609
2: 183624
3: 273771
4: 189942
Right 968669360 4:1840560-1840582 GGGAGGCTGAGGCAGGAGAATGG 0: 61556
1: 45979
2: 19513
3: 9543
4: 8794
968669355_968669366 12 Left 968669355 4:1840541-1840563 CCTGTAGTGCCAGCTACTCGGGA 0: 270
1: 57609
2: 183624
3: 273771
4: 189942
Right 968669366 4:1840576-1840598 AGAATGGTGTGGACCCCGGGGGG No data
968669355_968669361 1 Left 968669355 4:1840541-1840563 CCTGTAGTGCCAGCTACTCGGGA 0: 270
1: 57609
2: 183624
3: 273771
4: 189942
Right 968669361 4:1840565-1840587 GCTGAGGCAGGAGAATGGTGTGG 0: 79
1: 303
2: 387
3: 1936
4: 5874
968669355_968669363 9 Left 968669355 4:1840541-1840563 CCTGTAGTGCCAGCTACTCGGGA 0: 270
1: 57609
2: 183624
3: 273771
4: 189942
Right 968669363 4:1840573-1840595 AGGAGAATGGTGTGGACCCCGGG 0: 1
1: 64
2: 834
3: 1063
4: 1605
968669355_968669364 10 Left 968669355 4:1840541-1840563 CCTGTAGTGCCAGCTACTCGGGA 0: 270
1: 57609
2: 183624
3: 273771
4: 189942
Right 968669364 4:1840574-1840596 GGAGAATGGTGTGGACCCCGGGG 0: 1
1: 36
2: 444
3: 1285
4: 1611
968669355_968669365 11 Left 968669355 4:1840541-1840563 CCTGTAGTGCCAGCTACTCGGGA 0: 270
1: 57609
2: 183624
3: 273771
4: 189942
Right 968669365 4:1840575-1840597 GAGAATGGTGTGGACCCCGGGGG 0: 3
1: 165
2: 9284
3: 44412
4: 47187
968669355_968669362 8 Left 968669355 4:1840541-1840563 CCTGTAGTGCCAGCTACTCGGGA 0: 270
1: 57609
2: 183624
3: 273771
4: 189942
Right 968669362 4:1840572-1840594 CAGGAGAATGGTGTGGACCCCGG 0: 49
1: 8647
2: 45634
3: 44912
4: 109058

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968669355 Original CRISPR TCCCGAGTAGCTGGCACTAC AGG (reversed) Intronic
Too many off-targets to display for this crispr