ID: 968669366

View in Genome Browser
Species Human (GRCh38)
Location 4:1840576-1840598
Sequence AGAATGGTGTGGACCCCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968669355_968669366 12 Left 968669355 4:1840541-1840563 CCTGTAGTGCCAGCTACTCGGGA 0: 270
1: 57609
2: 183624
3: 273771
4: 189942
Right 968669366 4:1840576-1840598 AGAATGGTGTGGACCCCGGGGGG No data
968669358_968669366 3 Left 968669358 4:1840550-1840572 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 968669366 4:1840576-1840598 AGAATGGTGTGGACCCCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968669366 Original CRISPR AGAATGGTGTGGACCCCGGG GGG Intronic
No off target data available for this crispr