ID: 968671278

View in Genome Browser
Species Human (GRCh38)
Location 4:1853109-1853131
Sequence GGGGAGGAGCAGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2256
Summary {0: 1, 1: 0, 2: 12, 3: 233, 4: 2010}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671278_968671292 28 Left 968671278 4:1853109-1853131 CCCTCCTCATTCTGCTCCTCCCC 0: 1
1: 0
2: 12
3: 233
4: 2010
Right 968671292 4:1853160-1853182 CTGTTGTCCCCAGGCGGCTCAGG No data
968671278_968671291 22 Left 968671278 4:1853109-1853131 CCCTCCTCATTCTGCTCCTCCCC 0: 1
1: 0
2: 12
3: 233
4: 2010
Right 968671291 4:1853154-1853176 ATGGCACTGTTGTCCCCAGGCGG 0: 1
1: 0
2: 2
3: 12
4: 152
968671278_968671285 3 Left 968671278 4:1853109-1853131 CCCTCCTCATTCTGCTCCTCCCC 0: 1
1: 0
2: 12
3: 233
4: 2010
Right 968671285 4:1853135-1853157 TCCTCCCCAGTTTCAACAAATGG 0: 1
1: 0
2: 1
3: 10
4: 156
968671278_968671290 19 Left 968671278 4:1853109-1853131 CCCTCCTCATTCTGCTCCTCCCC 0: 1
1: 0
2: 12
3: 233
4: 2010
Right 968671290 4:1853151-1853173 CAAATGGCACTGTTGTCCCCAGG 0: 1
1: 0
2: 3
3: 15
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671278 Original CRISPR GGGGAGGAGCAGAATGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr