ID: 968671882

View in Genome Browser
Species Human (GRCh38)
Location 4:1856343-1856365
Sequence CAGCCGCCCCGGTGCACGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 160}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671882_968671891 19 Left 968671882 4:1856343-1856365 CCCGGCGTGCACCGGGGCGGCTG 0: 1
1: 0
2: 1
3: 10
4: 160
Right 968671891 4:1856385-1856407 TCCTGGTTCCCGTCGTACCGTGG 0: 1
1: 0
2: 0
3: 2
4: 23
968671882_968671889 2 Left 968671882 4:1856343-1856365 CCCGGCGTGCACCGGGGCGGCTG 0: 1
1: 0
2: 1
3: 10
4: 160
Right 968671889 4:1856368-1856390 TCCTGGGGCTCGCTGCATCCTGG 0: 1
1: 0
2: 1
3: 16
4: 169
968671882_968671895 27 Left 968671882 4:1856343-1856365 CCCGGCGTGCACCGGGGCGGCTG 0: 1
1: 0
2: 1
3: 10
4: 160
Right 968671895 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 13
968671882_968671897 28 Left 968671882 4:1856343-1856365 CCCGGCGTGCACCGGGGCGGCTG 0: 1
1: 0
2: 1
3: 10
4: 160
Right 968671897 4:1856394-1856416 CCGTCGTACCGTGGACGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 12
968671882_968671893 26 Left 968671882 4:1856343-1856365 CCCGGCGTGCACCGGGGCGGCTG 0: 1
1: 0
2: 1
3: 10
4: 160
Right 968671893 4:1856392-1856414 TCCCGTCGTACCGTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671882 Original CRISPR CAGCCGCCCCGGTGCACGCC GGG (reversed) Intergenic