ID: 968671883

View in Genome Browser
Species Human (GRCh38)
Location 4:1856344-1856366
Sequence CCAGCCGCCCCGGTGCACGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671883_968671893 25 Left 968671883 4:1856344-1856366 CCGGCGTGCACCGGGGCGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 968671893 4:1856392-1856414 TCCCGTCGTACCGTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 8
968671883_968671897 27 Left 968671883 4:1856344-1856366 CCGGCGTGCACCGGGGCGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 968671897 4:1856394-1856416 CCGTCGTACCGTGGACGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 12
968671883_968671891 18 Left 968671883 4:1856344-1856366 CCGGCGTGCACCGGGGCGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 968671891 4:1856385-1856407 TCCTGGTTCCCGTCGTACCGTGG 0: 1
1: 0
2: 0
3: 2
4: 23
968671883_968671889 1 Left 968671883 4:1856344-1856366 CCGGCGTGCACCGGGGCGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 968671889 4:1856368-1856390 TCCTGGGGCTCGCTGCATCCTGG 0: 1
1: 0
2: 1
3: 16
4: 169
968671883_968671895 26 Left 968671883 4:1856344-1856366 CCGGCGTGCACCGGGGCGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 968671895 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 13

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671883 Original CRISPR CCAGCCGCCCCGGTGCACGC CGG (reversed) Intergenic