ID: 968671888

View in Genome Browser
Species Human (GRCh38)
Location 4:1856354-1856376
Sequence GCCCCAGGAGCCAGCCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 6, 3: 27, 4: 408}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671888_968671891 8 Left 968671888 4:1856354-1856376 CCGGGGCGGCTGGCTCCTGGGGC 0: 1
1: 0
2: 6
3: 27
4: 408
Right 968671891 4:1856385-1856407 TCCTGGTTCCCGTCGTACCGTGG 0: 1
1: 0
2: 0
3: 2
4: 23
968671888_968671899 29 Left 968671888 4:1856354-1856376 CCGGGGCGGCTGGCTCCTGGGGC 0: 1
1: 0
2: 6
3: 27
4: 408
Right 968671899 4:1856406-1856428 GGACGCCGGGGCTCGCAGCGTGG 0: 1
1: 0
2: 1
3: 22
4: 115
968671888_968671889 -9 Left 968671888 4:1856354-1856376 CCGGGGCGGCTGGCTCCTGGGGC 0: 1
1: 0
2: 6
3: 27
4: 408
Right 968671889 4:1856368-1856390 TCCTGGGGCTCGCTGCATCCTGG 0: 1
1: 0
2: 1
3: 16
4: 169
968671888_968671897 17 Left 968671888 4:1856354-1856376 CCGGGGCGGCTGGCTCCTGGGGC 0: 1
1: 0
2: 6
3: 27
4: 408
Right 968671897 4:1856394-1856416 CCGTCGTACCGTGGACGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 12
968671888_968671893 15 Left 968671888 4:1856354-1856376 CCGGGGCGGCTGGCTCCTGGGGC 0: 1
1: 0
2: 6
3: 27
4: 408
Right 968671893 4:1856392-1856414 TCCCGTCGTACCGTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 8
968671888_968671895 16 Left 968671888 4:1856354-1856376 CCGGGGCGGCTGGCTCCTGGGGC 0: 1
1: 0
2: 6
3: 27
4: 408
Right 968671895 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 13

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671888 Original CRISPR GCCCCAGGAGCCAGCCGCCC CGG (reversed) Intergenic