ID: 968671890

View in Genome Browser
Species Human (GRCh38)
Location 4:1856369-1856391
Sequence ACCAGGATGCAGCGAGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 169}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671890_968671895 1 Left 968671890 4:1856369-1856391 CCTGGGGCTCGCTGCATCCTGGT 0: 1
1: 0
2: 1
3: 16
4: 169
Right 968671895 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 13
968671890_968671902 24 Left 968671890 4:1856369-1856391 CCTGGGGCTCGCTGCATCCTGGT 0: 1
1: 0
2: 1
3: 16
4: 169
Right 968671902 4:1856416-1856438 GCTCGCAGCGTGGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 130
968671890_968671891 -7 Left 968671890 4:1856369-1856391 CCTGGGGCTCGCTGCATCCTGGT 0: 1
1: 0
2: 1
3: 16
4: 169
Right 968671891 4:1856385-1856407 TCCTGGTTCCCGTCGTACCGTGG 0: 1
1: 0
2: 0
3: 2
4: 23
968671890_968671900 17 Left 968671890 4:1856369-1856391 CCTGGGGCTCGCTGCATCCTGGT 0: 1
1: 0
2: 1
3: 16
4: 169
Right 968671900 4:1856409-1856431 CGCCGGGGCTCGCAGCGTGGCGG 0: 1
1: 0
2: 0
3: 13
4: 112
968671890_968671893 0 Left 968671890 4:1856369-1856391 CCTGGGGCTCGCTGCATCCTGGT 0: 1
1: 0
2: 1
3: 16
4: 169
Right 968671893 4:1856392-1856414 TCCCGTCGTACCGTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 8
968671890_968671897 2 Left 968671890 4:1856369-1856391 CCTGGGGCTCGCTGCATCCTGGT 0: 1
1: 0
2: 1
3: 16
4: 169
Right 968671897 4:1856394-1856416 CCGTCGTACCGTGGACGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 12
968671890_968671899 14 Left 968671890 4:1856369-1856391 CCTGGGGCTCGCTGCATCCTGGT 0: 1
1: 0
2: 1
3: 16
4: 169
Right 968671899 4:1856406-1856428 GGACGCCGGGGCTCGCAGCGTGG 0: 1
1: 0
2: 1
3: 22
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671890 Original CRISPR ACCAGGATGCAGCGAGCCCC AGG (reversed) Intergenic