ID: 968671892

View in Genome Browser
Species Human (GRCh38)
Location 4:1856386-1856408
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 9}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671892_968671905 22 Left 968671892 4:1856386-1856408 CCTGGTTCCCGTCGTACCGTGGA 0: 1
1: 0
2: 0
3: 1
4: 9
Right 968671905 4:1856431-1856453 GCCGCAGGAGCTGAGGGAGTCGG 0: 1
1: 0
2: 4
3: 40
4: 366
968671892_968671902 7 Left 968671892 4:1856386-1856408 CCTGGTTCCCGTCGTACCGTGGA 0: 1
1: 0
2: 0
3: 1
4: 9
Right 968671902 4:1856416-1856438 GCTCGCAGCGTGGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 130
968671892_968671900 0 Left 968671892 4:1856386-1856408 CCTGGTTCCCGTCGTACCGTGGA 0: 1
1: 0
2: 0
3: 1
4: 9
Right 968671900 4:1856409-1856431 CGCCGGGGCTCGCAGCGTGGCGG 0: 1
1: 0
2: 0
3: 13
4: 112
968671892_968671903 15 Left 968671892 4:1856386-1856408 CCTGGTTCCCGTCGTACCGTGGA 0: 1
1: 0
2: 0
3: 1
4: 9
Right 968671903 4:1856424-1856446 CGTGGCGGCCGCAGGAGCTGAGG 0: 1
1: 0
2: 3
3: 35
4: 337
968671892_968671899 -3 Left 968671892 4:1856386-1856408 CCTGGTTCCCGTCGTACCGTGGA 0: 1
1: 0
2: 0
3: 1
4: 9
Right 968671899 4:1856406-1856428 GGACGCCGGGGCTCGCAGCGTGG 0: 1
1: 0
2: 1
3: 22
4: 115
968671892_968671904 16 Left 968671892 4:1856386-1856408 CCTGGTTCCCGTCGTACCGTGGA 0: 1
1: 0
2: 0
3: 1
4: 9
Right 968671904 4:1856425-1856447 GTGGCGGCCGCAGGAGCTGAGGG 0: 1
1: 0
2: 1
3: 32
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671892 Original CRISPR TCCACGGTACGACGGGAACC AGG (reversed) Intergenic