ID: 968671893

View in Genome Browser
Species Human (GRCh38)
Location 4:1856392-1856414
Sequence TCCCGTCGTACCGTGGACGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 8}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671890_968671893 0 Left 968671890 4:1856369-1856391 CCTGGGGCTCGCTGCATCCTGGT 0: 1
1: 0
2: 1
3: 16
4: 169
Right 968671893 4:1856392-1856414 TCCCGTCGTACCGTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 8
968671882_968671893 26 Left 968671882 4:1856343-1856365 CCCGGCGTGCACCGGGGCGGCTG 0: 1
1: 0
2: 1
3: 10
4: 160
Right 968671893 4:1856392-1856414 TCCCGTCGTACCGTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 8
968671883_968671893 25 Left 968671883 4:1856344-1856366 CCGGCGTGCACCGGGGCGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 968671893 4:1856392-1856414 TCCCGTCGTACCGTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 8
968671888_968671893 15 Left 968671888 4:1856354-1856376 CCGGGGCGGCTGGCTCCTGGGGC 0: 1
1: 0
2: 6
3: 27
4: 408
Right 968671893 4:1856392-1856414 TCCCGTCGTACCGTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671893 Original CRISPR TCCCGTCGTACCGTGGACGC CGG Intergenic