ID: 968671894

View in Genome Browser
Species Human (GRCh38)
Location 4:1856393-1856415
Sequence CCCGGCGTCCACGGTACGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 15}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671894_968671908 30 Left 968671894 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 968671908 4:1856446-1856468 GGAGTCGGCCGCGCTTGCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 77
968671894_968671904 9 Left 968671894 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 968671904 4:1856425-1856447 GTGGCGGCCGCAGGAGCTGAGGG 0: 1
1: 0
2: 1
3: 32
4: 301
968671894_968671903 8 Left 968671894 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 968671903 4:1856424-1856446 CGTGGCGGCCGCAGGAGCTGAGG 0: 1
1: 0
2: 3
3: 35
4: 337
968671894_968671899 -10 Left 968671894 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 968671899 4:1856406-1856428 GGACGCCGGGGCTCGCAGCGTGG 0: 1
1: 0
2: 1
3: 22
4: 115
968671894_968671905 15 Left 968671894 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 968671905 4:1856431-1856453 GCCGCAGGAGCTGAGGGAGTCGG 0: 1
1: 0
2: 4
3: 40
4: 366
968671894_968671900 -7 Left 968671894 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 968671900 4:1856409-1856431 CGCCGGGGCTCGCAGCGTGGCGG 0: 1
1: 0
2: 0
3: 13
4: 112
968671894_968671907 29 Left 968671894 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 968671907 4:1856445-1856467 GGGAGTCGGCCGCGCTTGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 57
968671894_968671902 0 Left 968671894 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 968671902 4:1856416-1856438 GCTCGCAGCGTGGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671894 Original CRISPR CCCGGCGTCCACGGTACGAC GGG (reversed) Intergenic