ID: 968671895

View in Genome Browser
Species Human (GRCh38)
Location 4:1856393-1856415
Sequence CCCGTCGTACCGTGGACGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 15
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 13}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671882_968671895 27 Left 968671882 4:1856343-1856365 CCCGGCGTGCACCGGGGCGGCTG 0: 1
1: 0
2: 1
3: 10
4: 160
Right 968671895 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 13
968671890_968671895 1 Left 968671890 4:1856369-1856391 CCTGGGGCTCGCTGCATCCTGGT 0: 1
1: 0
2: 1
3: 16
4: 169
Right 968671895 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 13
968671883_968671895 26 Left 968671883 4:1856344-1856366 CCGGCGTGCACCGGGGCGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 968671895 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 13
968671888_968671895 16 Left 968671888 4:1856354-1856376 CCGGGGCGGCTGGCTCCTGGGGC 0: 1
1: 0
2: 6
3: 27
4: 408
Right 968671895 4:1856393-1856415 CCCGTCGTACCGTGGACGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 13

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671895 Original CRISPR CCCGTCGTACCGTGGACGCC GGG Intergenic