ID: 968671897

View in Genome Browser
Species Human (GRCh38)
Location 4:1856394-1856416
Sequence CCGTCGTACCGTGGACGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 12}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671883_968671897 27 Left 968671883 4:1856344-1856366 CCGGCGTGCACCGGGGCGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 968671897 4:1856394-1856416 CCGTCGTACCGTGGACGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 12
968671882_968671897 28 Left 968671882 4:1856343-1856365 CCCGGCGTGCACCGGGGCGGCTG 0: 1
1: 0
2: 1
3: 10
4: 160
Right 968671897 4:1856394-1856416 CCGTCGTACCGTGGACGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 12
968671890_968671897 2 Left 968671890 4:1856369-1856391 CCTGGGGCTCGCTGCATCCTGGT 0: 1
1: 0
2: 1
3: 16
4: 169
Right 968671897 4:1856394-1856416 CCGTCGTACCGTGGACGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 12
968671888_968671897 17 Left 968671888 4:1856354-1856376 CCGGGGCGGCTGGCTCCTGGGGC 0: 1
1: 0
2: 6
3: 27
4: 408
Right 968671897 4:1856394-1856416 CCGTCGTACCGTGGACGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671897 Original CRISPR CCGTCGTACCGTGGACGCCG GGG Intergenic