ID: 968671898

View in Genome Browser
Species Human (GRCh38)
Location 4:1856402-1856424
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 86}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968671898_968671909 22 Left 968671898 4:1856402-1856424 CCGTGGACGCCGGGGCTCGCAGC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 968671909 4:1856447-1856469 GAGTCGGCCGCGCTTGCGCGGGG 0: 1
1: 0
2: 2
3: 3
4: 40
968671898_968671902 -9 Left 968671898 4:1856402-1856424 CCGTGGACGCCGGGGCTCGCAGC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 968671902 4:1856416-1856438 GCTCGCAGCGTGGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 130
968671898_968671907 20 Left 968671898 4:1856402-1856424 CCGTGGACGCCGGGGCTCGCAGC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 968671907 4:1856445-1856467 GGGAGTCGGCCGCGCTTGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 57
968671898_968671905 6 Left 968671898 4:1856402-1856424 CCGTGGACGCCGGGGCTCGCAGC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 968671905 4:1856431-1856453 GCCGCAGGAGCTGAGGGAGTCGG 0: 1
1: 0
2: 4
3: 40
4: 366
968671898_968671908 21 Left 968671898 4:1856402-1856424 CCGTGGACGCCGGGGCTCGCAGC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 968671908 4:1856446-1856468 GGAGTCGGCCGCGCTTGCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 77
968671898_968671903 -1 Left 968671898 4:1856402-1856424 CCGTGGACGCCGGGGCTCGCAGC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 968671903 4:1856424-1856446 CGTGGCGGCCGCAGGAGCTGAGG 0: 1
1: 0
2: 3
3: 35
4: 337
968671898_968671904 0 Left 968671898 4:1856402-1856424 CCGTGGACGCCGGGGCTCGCAGC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 968671904 4:1856425-1856447 GTGGCGGCCGCAGGAGCTGAGGG 0: 1
1: 0
2: 1
3: 32
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968671898 Original CRISPR GCTGCGAGCCCCGGCGTCCA CGG (reversed) Intergenic